View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6876A_low_218 (Length: 250)

Name: NF6876A_low_218
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6876A_low_218
NF6876A_low_218
[»] chr5 (1 HSPs)
chr5 (1-228)||(19190312-19190539)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 19190312 - 19190539
Alignment:
1 gtggtggttatggttcgaatgggcgttccggtggtggttatgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccga 100  Q
    |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19190312 gtggtggttatggttctaatggtcgttccggtggtggttatgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccga 19190411  T
101 tgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctgggggtggatatggtgatggagggcgtacgagtattggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
19190412 tgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatggtgatggagggcgttcgagtattggt 19190511  T
201 ggatatggcgaagaaaaccgttctagtg 228  Q
    ||||||||||||||||||||||||||||    
19190512 ggatatggcgaagaaaaccgttctagtg 19190539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University