View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_229 (Length: 250)
Name: NF6876A_low_229
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_229 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 245
Target Start/End: Original strand, 29356333 - 29356573
Alignment:
| Q |
5 |
gacatcaaggagcttctcaggtaattttctgctattgatggtgcataactgtgtttatattagcaaatactgttgtatgaactaataatatagtgttggc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29356333 |
gacatcaaggagcttctcaggtaattttctgctattgatggtgcataactgtgtttatattagcaaatactgttgtatgaactaataatatagtgttggc |
29356432 |
T |
|
| Q |
105 |
tgcaatatctagttcgatgaattcaatactaattttgattcagatgaaaaaacaccagaaaaacgtgatgaattcgatgctcgtctagtacataagatgt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
29356433 |
tgcaatatctagttcgatgaattcaatactaattttgattcagatgaaaaaacaccagaaaaacgtgattaatttgatgctcgtttagtacataagatgt |
29356532 |
T |
|
| Q |
205 |
taactcgttagccttcgatgactgcaccaatcttctttgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29356533 |
taactcgttagccttcgatgactgcaccaatcttctttgct |
29356573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University