View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_233 (Length: 250)
Name: NF6876A_low_233
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_233 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 48938831 - 48938972
Alignment:
| Q |
1 |
gttgatgattgaatttctgataatttttccgattgtatgcacaggtttgggacatggcaaagcttggacaacaaccctccagttgtgagtttgaatttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48938831 |
gttgatgattgaatttctgataatttttccgattgtatgcacaggtttgggacatggcaaagcttggacaacaaccctccagttgtgagtttgaatttgg |
48938930 |
T |
 |
| Q |
101 |
ttatttcttttgtttagattaatctatgactcatgcattctt |
142 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
48938931 |
ttatttcttttgtttagactaatctatgactcgtgcattctt |
48938972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 48938803 - 48938700
Alignment:
| Q |
137 |
attcttcgagatagatggatgatggggaatgcatattaaaaagacctttagtgatgagtcagaaaatcctccagcaaccaatgatccatcatgggatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48938803 |
attcttcgagatagatggatgatggggaatgcatattaaaaagacctttagtgatgagtcagaaaatcctccagcaaccaatgatccatcatgggatatt |
48938704 |
T |
 |
| Q |
237 |
gatg |
240 |
Q |
| |
|
|||| |
|
|
| T |
48938703 |
gatg |
48938700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University