View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_238 (Length: 250)
Name: NF6876A_low_238
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_238 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 34 - 238
Target Start/End: Complemental strand, 11527526 - 11527322
Alignment:
| Q |
34 |
gttttcttctgttctttctcaatttgaatttgcacctcataggttttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttattt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527526 |
gttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttattt |
11527427 |
T |
|
| Q |
134 |
tatacatgtataatgtaggaacgaaatatgtggacgcgtgtctgcaaatttgaaagagaaacagttcttttaagtttcaatatacagtgccctggttata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11527426 |
tatacatgtataatgtaggaacgaaatatgtggatgcgtgtctgcaaatttgaaagagaaacagttctttcaagtttcaatatacagtgccctggttata |
11527327 |
T |
|
| Q |
234 |
atatt |
238 |
Q |
| |
|
||||| |
|
|
| T |
11527326 |
atatt |
11527322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University