View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_240 (Length: 249)
Name: NF6876A_low_240
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_240 |
 | |
|
| [»] scaffold1051 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold1051 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold1051
Description:
Target: scaffold1051; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 2205 - 2442
Alignment:
| Q |
12 |
gatggacatcaacaggatttcattaatcacttcttgaggaagatgttcgctcttcttcgccattttgtggaggcacttatgcgtttgagttggactatct |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2205 |
gatggacctcaacaggatttcattaatcacttcttgaggaagatgttcgctcttcttcgccattttgcggaggcacttatgcgtttgagttggactatct |
2304 |
T |
|
| Q |
112 |
cacactttatttatacacaaaaaatctgttaagttgccttgctcacttgattattccttatttgctactatatgatgaactctttcccaatgcactttgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305 |
cacactttatttatacacaaaaaatctgttaagttgccttgctcacttgattattccttatttgctactatatgatgaactctttcccaatgcactttgt |
2404 |
T |
|
| Q |
212 |
aaaatgcattactccactcaaacaaagattgtgcaaaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2405 |
aaaatgcattactccactcaaacaaagattgtgcaaaa |
2442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University