View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_249 (Length: 249)
Name: NF6876A_low_249
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_249 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 237
Target Start/End: Complemental strand, 34165734 - 34165504
Alignment:
| Q |
7 |
atcatttccattcagccctcttttgtatcttcccatattctgcctacttaaccaaatgggccctaaatatgtttttgacctacgaaaaaccccccgactc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34165734 |
atcatttccattcagccctcttttgtatcttcccatattctgcctacttaaccaaatgggccctaaatatgttttagacctacgaaaacccccccgactc |
34165635 |
T |
|
| Q |
107 |
cctacaaaaacacaacttaaaagactattcaaaatcttgaatatgatgtagcaaccattccatagagctcatattgttatgatccatctcctcaaaaaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
34165634 |
cctacaaaaacacaacttaaaagactattcaaaatcttgaatatgatgtagcaaccattccatagagctcatattgttaagatccatctccccaaaaaag |
34165535 |
T |
|
| Q |
207 |
taattattacaaaaataaatgtgacgatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
34165534 |
taattattacaaaaataaatgtgacaatatt |
34165504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University