View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_258 (Length: 248)
Name: NF6876A_low_258
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_258 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 24014186 - 24013948
Alignment:
| Q |
10 |
cagagaggaaagaaggacgattgcacctgagcatgtattgaaagctttaggggtattcatctaatgaccaaaccatttaatctccaaattttgatgtgga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24014186 |
cagagaggaaagaaggacgattgcacctgagcatgtattgaaagctttaggggtattcatctaatgaacaaaccatttaatctccaaattttgatgtgga |
24014087 |
T |
|
| Q |
110 |
tccttttcaattttaatttgattgcttatattatacgccctcttcttggacgttctgtgcattgatttgtatctttctcatgtggttccttttcaatggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24014086 |
tccttttcaattttaatttgattgcttatataatacgctctcttcttggacgttctgtgcattgatttgtatctttctcatgtggatccttttcaatggt |
24013987 |
T |
|
| Q |
210 |
gttattcttgatttttctttgcattgtagttgggtttga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24013986 |
gttattcttgatttttctttgcattgtagttgggtttga |
24013948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University