View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_262 (Length: 247)
Name: NF6876A_low_262
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_262 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 48231823 - 48232050
Alignment:
| Q |
11 |
gatggacatcatcggagccttatagtaaattctcaaactaaaaaaccaagggacagacaaaattataaagtgaaagtgagtgtcctgcattatctaactt |
110 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231823 |
gatgtacattatcggagccttatagcaaattctcaaactaaaaaaccaagggacagacaaaattataaagtgaaagtgagtgtcctgcattatctaactt |
48231922 |
T |
|
| Q |
111 |
tttgcctttgacccatgtcacaagtattacagtaaccttatcttaaatgggtcattcttgatatatgtcagtatgcagacattgaaaatacaaacttttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231923 |
tttgcctttgacccatgtcacaagtattacagtaaccttatcttaaatgggtcattcttgatatatgtcagtatgcagacattgaaaatacaaacttttt |
48232022 |
T |
|
| Q |
211 |
catactatcttgatggttatattgttgg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48232023 |
catactatcttgatggttatattgttgg |
48232050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University