View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_277 (Length: 245)
Name: NF6876A_low_277
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_277 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 48484384 - 48484621
Alignment:
| Q |
1 |
ctgatcatgtacaagaaatggaagtttcagtatgtaaaagttcatatgaaatgcatgcttaccttgcaaaaaggaaaacacctgtttctgatttaacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484384 |
ctgatcatgtacaagaaatggaagtttcagtatgtaaaagttcatatgaaatgcatgcttaccttgcaaaaaggaaaacacctgtttctgatttaacttc |
48484483 |
T |
|
| Q |
101 |
atgggaattccagcttggggattgtgttccgtgatctgaagaaatttgttttgttatttcaaaaatgagaaagaagcgcagaagtattatggagatatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48484484 |
atgggaattccagcttggggattgtgttccgtgatctgaagaaatttgttttgttatttcaaaaatgagaaagaagcgcagaaatattatggagatatga |
48484583 |
T |
|
| Q |
201 |
agacacggtacacacaacactacaggactatatctttg |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48484584 |
agacacggtacacacaacactgcaggactatatctttg |
48484621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University