View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6876A_low_285 (Length: 244)

Name: NF6876A_low_285
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6876A_low_285
NF6876A_low_285
[»] chr3 (1 HSPs)
chr3 (159-234)||(50422786-50422861)


Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 234
Target Start/End: Original strand, 50422786 - 50422861
Alignment:
159 accattagtctcttctatatatgcttatttttagcttatnnnnnnntcgctagatcataaaattttgttcgaacac 234  Q
    |||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
50422786 accattagtctcttctatatatgcttatttttagcttataaaaaaatcgctagatcataaaattttgttcgaacac 50422861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University