View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_300 (Length: 242)
Name: NF6876A_low_300
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_300 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 28551173 - 28550938
Alignment:
| Q |
7 |
taaataatactcgagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgag |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551173 |
taaattatactcgagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgag |
28551074 |
T |
|
| Q |
107 |
tctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagagtctctagcacattaattcagtttta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28551073 |
tctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagattctctagcacattaattcagtttta |
28550974 |
T |
|
| Q |
207 |
ttgaaatgtgtttaatatggcatgaaccttgtgatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550973 |
ttgaaatgtgtttaatatggcatgaaccttgtgatt |
28550938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University