View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6876A_low_319 (Length: 237)

Name: NF6876A_low_319
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6876A_low_319
NF6876A_low_319
[»] chr8 (1 HSPs)
chr8 (171-235)||(33152609-33152673)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 33152609 - 33152673
Alignment:
171 accgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctc 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33152609 accgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctc 33152673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University