View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_325 (Length: 235)
Name: NF6876A_low_325
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_325 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 4 - 121
Target Start/End: Complemental strand, 36406251 - 36406134
Alignment:
| Q |
4 |
atcccaaaatactaccaacaatccttttcaatccaagtaaaaggtaaatcatttgtaaaataggaaaatttgagaagttaagacatgctggcgacaacct |
103 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36406251 |
atcccaaacaactaccaacaatccttttcaatccaagtgaaaggtaaatcatatgtaaaataggaaaatttgagaagttaagacatgttggcgacaacct |
36406152 |
T |
|
| Q |
104 |
tagattacatgccagcac |
121 |
Q |
| |
|
||| |||||||| ||||| |
|
|
| T |
36406151 |
tagtttacatgctagcac |
36406134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 36406076 - 36406020
Alignment:
| Q |
179 |
gttagatctaggtgattaatgactatacgcttcacatacatacttactgaaatagaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36406076 |
gttagatctaggtgattaatgactatacgcttcacatacatacttactgaaatagaa |
36406020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University