View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_371 (Length: 229)
Name: NF6876A_low_371
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_371 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 34092600 - 34092372
Alignment:
| Q |
1 |
ttataattaatttaaaaaatcttttattgtaggcttgttaaagannnnnnnaaaaccaatattgatgttttaattaaatttgaaatatattttnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
34092600 |
ttataattaatttaaaaaatcttttattgtaggcttgttaaagatttttttaaaaccaattttgatgttttaattaaatttgaaagatattttaaaaaaa |
34092501 |
T |
|
| Q |
101 |
cgatgttatgttaaagatgaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgtgattt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092500 |
cgatgttatgttaaagattaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgtgattt |
34092401 |
T |
|
| Q |
201 |
gttttcaaaggagattgtatatgatgtga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34092400 |
gttttcaaaggagattgtatatgatgtga |
34092372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University