View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_380 (Length: 228)
Name: NF6876A_low_380
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_380 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 44201934 - 44201732
Alignment:
| Q |
13 |
gacatcatctatggaggagacttatttgaatttgcataagatgaaatgtgtgaatttgttgagatctgctgacacaacaacaataaaatatatttttcct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44201934 |
gacatcatctatggaggagacttatttgaatttgcatcggatgaaatgtatgaatttgttgagatctgctgacacaacaacaataaaatatatttttctt |
44201835 |
T |
|
| Q |
113 |
tttcttttagtgagattataattgaaataaaatgattatgttgagtttgacataaaatgaattaagttggcgaaattattgagatttgttaaatattctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| || |
|
|
| T |
44201834 |
tttcttttagtgagattataattgaaataaaatgattatattgagtttgacataaaatgaattgagttggcgaaattattgaaatttgttaaatattgtt |
44201735 |
T |
|
| Q |
213 |
gga |
215 |
Q |
| |
|
||| |
|
|
| T |
44201734 |
gga |
44201732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University