View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_385 (Length: 227)
Name: NF6876A_low_385
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_385 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 5337063 - 5336877
Alignment:
| Q |
19 |
catctagttatttccgtatctgtttgatagttggtagtagtatatcatgtcttgcatacctcacgggttgaacttaaagcaagggttatgtgttaaaaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5337063 |
catctagttatttccgtatctgtttgatagttggtagtagtatatcatgtcttgcatacctcacgggttgaacttaaagcgagggttatgtgttaaaaca |
5336964 |
T |
 |
| Q |
119 |
tatttcttactagacagtatggttagatatgttttttgtctctatgtaattggtattagttatttaaagttttatattagttatttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5336963 |
tatttcttactagacagtatggttagatatgttttttgtctctatgtaattggcattagttatttaaagttttatattagttatttt |
5336877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 5376743 - 5376702
Alignment:
| Q |
162 |
atgtaattggtattagttatttaaagttttatattagttatt |
203 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
5376743 |
atgtaattgttattggttatttaaagttttatattaattatt |
5376702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 5428488 - 5428447
Alignment:
| Q |
162 |
atgtaattggtattagttatttaaagttttatattagttatt |
203 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
5428488 |
atgtaattgctattagttatttagagttttatattatttatt |
5428447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University