View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6876A_low_387 (Length: 226)

Name: NF6876A_low_387
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6876A_low_387
NF6876A_low_387
[»] chr8 (16 HSPs)
chr8 (1-226)||(22081062-22081287)
chr8 (1-198)||(44562932-44563132)
chr8 (1-198)||(9354453-9354653)
chr8 (1-198)||(19659223-19659423)
chr8 (32-226)||(19286265-19286459)
chr8 (74-226)||(31490013-31490165)
chr8 (74-226)||(19674238-19674390)
chr8 (74-226)||(28362218-28362370)
chr8 (71-226)||(19687898-19688053)
chr8 (71-156)||(16277424-16277509)
chr8 (71-156)||(27609165-27609250)
chr8 (71-159)||(18710453-18710541)
chr8 (74-226)||(19208623-19208775)
chr8 (74-225)||(33258524-33258675)
chr8 (71-156)||(2137519-2137604)
chr8 (119-156)||(19518451-19518488)
[»] chr4 (25 HSPs)
chr4 (1-226)||(15391563-15391789)
chr4 (1-226)||(14235750-14235981)
chr4 (1-226)||(15285153-15285381)
chr4 (1-226)||(15227688-15227916)
chr4 (1-226)||(1900075-1900303)
chr4 (74-226)||(5005685-5005837)
chr4 (74-226)||(30753557-30753709)
chr4 (71-226)||(21969516-21969671)
chr4 (71-226)||(27163618-27163773)
chr4 (74-226)||(33674114-33674266)
chr4 (74-226)||(39850438-39850590)
chr4 (32-226)||(54833205-54833399)
chr4 (1-198)||(24460830-24461030)
chr4 (71-226)||(24592612-24592767)
chr4 (71-156)||(17013885-17013970)
chr4 (119-226)||(14098356-14098463)
chr4 (119-226)||(31126867-31126974)
chr4 (71-156)||(14664903-14664988)
chr4 (71-159)||(14763605-14763693)
chr4 (119-219)||(18800971-18801071)
chr4 (71-159)||(24112547-24112635)
chr4 (71-159)||(34189258-34189346)
chr4 (74-226)||(40105942-40106094)
chr4 (74-156)||(6569738-6569820)
chr4 (119-159)||(19373143-19373183)
[»] scaffold0109 (1 HSPs)
scaffold0109 (1-226)||(21367-21592)
[»] chr2 (40 HSPs)
chr2 (54-218)||(27392797-27392961)
chr2 (1-226)||(19456635-19456863)
chr2 (1-198)||(31891542-31891742)
chr2 (1-226)||(21703378-21703606)
chr2 (2-198)||(27118515-27118714)
chr2 (71-226)||(32049594-32049749)
chr2 (1-198)||(34156838-34157038)
chr2 (1-198)||(34303517-34303717)
chr2 (74-226)||(11635482-11635634)
chr2 (74-226)||(11641671-11641823)
chr2 (1-198)||(3784481-3784681)
chr2 (1-198)||(16163426-16163626)
chr2 (74-226)||(261058-261210)
chr2 (74-226)||(12586597-12586749)
chr2 (74-226)||(21677475-21677627)
chr2 (71-226)||(34279245-34279400)
chr2 (74-226)||(13936837-13936989)
chr2 (119-226)||(12716943-12717050)
chr2 (71-226)||(27434734-27434889)
chr2 (74-226)||(27803488-27803640)
chr2 (74-226)||(37925289-37925441)
chr2 (74-226)||(40233295-40233447)
chr2 (119-226)||(16829676-16829783)
chr2 (119-226)||(16891698-16891805)
chr2 (71-226)||(28882010-28882165)
chr2 (71-156)||(12655408-12655493)
chr2 (71-156)||(20837784-20837869)
chr2 (71-156)||(23128856-23128941)
chr2 (1-33)||(27392964-27392996)
chr2 (74-226)||(27777003-27777155)
chr2 (74-226)||(27816770-27816922)
chr2 (74-226)||(31876077-31876229)
chr2 (74-226)||(34861476-34861628)
chr2 (74-226)||(37686202-37686354)
chr2 (74-226)||(37701467-37701619)
chr2 (74-225)||(19416792-19416943)
chr2 (71-226)||(34286150-34286305)
chr2 (71-226)||(34291210-34291365)
chr2 (119-226)||(39889858-39889965)
chr2 (74-159)||(39052121-39052206)
[»] chr1 (7 HSPs)
chr1 (1-226)||(16208256-16208481)
chr1 (54-226)||(20460907-20461079)
chr1 (1-198)||(20340560-20340760)
chr1 (72-226)||(41793610-41793764)
chr1 (74-225)||(28584781-28584932)
chr1 (74-226)||(10962469-10962621)
chr1 (119-226)||(51638017-51638124)
[»] chr6 (28 HSPs)
chr6 (2-226)||(20160501-20160728)
chr6 (2-226)||(22172103-22172330)
chr6 (1-198)||(28162485-28162685)
chr6 (1-226)||(22477441-22477672)
chr6 (1-198)||(8892478-8892678)
chr6 (1-198)||(13522241-13522441)
chr6 (1-198)||(33374424-33374624)
chr6 (71-226)||(26918177-26918332)
chr6 (1-198)||(8903713-8903913)
chr6 (74-226)||(3695860-3696012)
chr6 (74-226)||(34463608-34463760)
chr6 (71-226)||(26999870-27000025)
chr6 (119-226)||(30558308-30558415)
chr6 (32-226)||(4525086-4525280)
chr6 (74-226)||(16673924-16674076)
chr6 (71-226)||(26988798-26988953)
chr6 (71-156)||(13299195-13299280)
chr6 (71-156)||(15424561-15424646)
chr6 (71-156)||(16749721-16749806)
chr6 (71-108)||(22935121-22935158)
chr6 (71-108)||(23857566-23857603)
chr6 (71-159)||(29549342-29549430)
chr6 (74-226)||(29572810-29572962)
chr6 (74-225)||(16944274-16944425)
chr6 (71-226)||(24304862-24305017)
chr6 (119-226)||(27007509-27007616)
chr6 (119-225)||(26777919-26778025)
chr6 (71-156)||(24863584-24863669)
[»] chr3 (42 HSPs)
chr3 (1-226)||(16626772-16627000)
chr3 (1-226)||(18530158-18530380)
chr3 (71-226)||(7996323-7996478)
chr3 (71-226)||(10642831-10642986)
chr3 (1-198)||(17994050-17994250)
chr3 (74-226)||(28116302-28116454)
chr3 (74-226)||(47023214-47023366)
chr3 (1-198)||(4625736-4625936)
chr3 (74-226)||(11110706-11110858)
chr3 (74-226)||(51781772-51781924)
chr3 (74-226)||(51796861-51797013)
chr3 (71-226)||(4721392-4721547)
chr3 (71-226)||(7072973-7073128)
chr3 (1-198)||(5652179-5652379)
chr3 (74-226)||(20577207-20577359)
chr3 (74-226)||(29665330-29665482)
chr3 (74-226)||(36997434-36997586)
chr3 (71-226)||(4796995-4797150)
chr3 (71-226)||(6192077-6192232)
chr3 (119-226)||(17985346-17985453)
chr3 (71-226)||(35880527-35880682)
chr3 (80-198)||(5713016-5713134)
chr3 (80-198)||(5723926-5724044)
chr3 (80-198)||(5757433-5757551)
chr3 (80-198)||(5768324-5768442)
chr3 (32-226)||(8211502-8211696)
chr3 (74-159)||(48465743-48465828)
chr3 (74-226)||(5013473-5013625)
chr3 (74-226)||(18224952-18225104)
chr3 (119-226)||(5466746-5466853)
chr3 (71-226)||(15741424-15741579)
chr3 (119-226)||(22871264-22871371)
chr3 (119-226)||(22886323-22886430)
chr3 (71-156)||(8295806-8295891)
chr3 (71-159)||(4893041-4893129)
chr3 (71-159)||(18277394-18277482)
chr3 (71-159)||(18292695-18292783)
chr3 (71-159)||(18307996-18308084)
chr3 (71-159)||(32438985-32439073)
chr3 (119-226)||(6542864-6542971)
chr3 (74-225)||(24327921-24328072)
chr3 (119-156)||(29149145-29149182)
[»] chr7 (23 HSPs)
chr7 (1-226)||(16450109-16450337)
chr7 (1-226)||(16041127-16041355)
chr7 (1-198)||(31088575-31088775)
chr7 (1-198)||(45733292-45733492)
chr7 (74-226)||(3445095-3445247)
chr7 (74-226)||(5147530-5147682)
chr7 (71-226)||(5127793-5127948)
chr7 (71-226)||(16503567-16503722)
chr7 (71-226)||(16518603-16518758)
chr7 (74-226)||(11441361-11441513)
chr7 (74-226)||(45387144-45387296)
chr7 (74-159)||(26435125-26435210)
chr7 (41-226)||(2154374-2154559)
chr7 (71-226)||(4145310-4145465)
chr7 (74-159)||(26485934-26486019)
chr7 (74-159)||(26538063-26538148)
chr7 (71-159)||(5159390-5159478)
chr7 (74-226)||(9618452-9618604)
chr7 (74-226)||(24592731-24592883)
chr7 (74-226)||(26275284-26275436)
chr7 (74-226)||(26320059-26320211)
chr7 (71-226)||(11424963-11425118)
chr7 (71-156)||(10917052-10917137)
[»] scaffold0260 (1 HSPs)
scaffold0260 (1-198)||(2883-3083)
[»] chr5 (41 HSPs)
chr5 (1-221)||(22888287-22888510)
chr5 (1-226)||(23892015-23892246)
chr5 (1-198)||(13184770-13184970)
chr5 (1-198)||(13440616-13440816)
chr5 (1-198)||(33877087-33877287)
chr5 (74-226)||(8665676-8665828)
chr5 (2-156)||(24969903-24970057)
chr5 (1-198)||(11325634-11325834)
chr5 (74-226)||(18500949-18501101)
chr5 (74-226)||(30168278-30168430)
chr5 (1-159)||(25198908-25199069)
chr5 (74-219)||(43078065-43078210)
chr5 (74-218)||(31431245-31431389)
chr5 (119-226)||(18375658-18375765)
chr5 (71-226)||(22999312-22999467)
chr5 (119-226)||(24681246-24681353)
chr5 (119-226)||(24723773-24723880)
chr5 (119-226)||(33516165-33516272)
chr5 (71-226)||(33777296-33777451)
chr5 (71-156)||(9548741-9548826)
chr5 (74-226)||(30151827-30151979)
chr5 (74-226)||(37754777-37754929)
chr5 (74-226)||(40473753-40473905)
chr5 (71-226)||(11549163-11549318)
chr5 (71-226)||(23718186-23718341)
chr5 (71-226)||(23752648-23752803)
chr5 (28-159)||(33292404-33292535)
chr5 (74-226)||(3789335-3789487)
chr5 (74-226)||(5637719-5637871)
chr5 (74-226)||(9317260-9317412)
chr5 (74-226)||(12131964-12132116)
chr5 (74-226)||(15759058-15759210)
chr5 (74-226)||(26480201-26480353)
chr5 (74-226)||(31826620-31826772)
chr5 (74-226)||(37771200-37771352)
chr5 (71-226)||(15658958-15659113)
chr5 (74-225)||(29967267-29967418)
chr5 (74-225)||(30029225-30029376)
chr5 (119-156)||(28649105-28649142)
chr5 (71-156)||(30934515-30934600)
chr5 (74-155)||(41674589-41674670)
[»] scaffold0124 (2 HSPs)
scaffold0124 (54-226)||(20212-20384)
scaffold0124 (71-156)||(30323-30408)
[»] scaffold0029 (1 HSPs)
scaffold0029 (71-226)||(431-586)
[»] scaffold0237 (1 HSPs)
scaffold0237 (119-226)||(15279-15386)
[»] scaffold0143 (1 HSPs)
scaffold0143 (71-156)||(27162-27247)
[»] scaffold0496 (1 HSPs)
scaffold0496 (74-226)||(37-189)
[»] scaffold0144 (1 HSPs)
scaffold0144 (74-226)||(26506-26658)
[»] scaffold0089 (2 HSPs)
scaffold0089 (71-156)||(47286-47371)
scaffold0089 (71-108)||(40370-40407)
[»] scaffold0415 (1 HSPs)
scaffold0415 (80-219)||(5796-5936)
[»] scaffold0350 (1 HSPs)
scaffold0350 (74-226)||(7543-7695)
[»] scaffold0336 (1 HSPs)
scaffold0336 (71-218)||(8040-8187)
[»] scaffold0558 (1 HSPs)
scaffold0558 (1-39)||(253-291)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 16)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 22081062 - 22081287
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||    
22081062 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccaacggctgttgctgcatttgctgagcaatggcattgacgggtacctgaggt 22081161  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
22081162 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagctgagcagcattga 22081261  T
201 tgggggcaacagtagccatggattga 226  Q
    ||||||||||||||||||||||||||    
22081262 tgggggcaacagtagccatggattga 22081287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 44563132 - 44562932
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| |   |||||| ||||||||||||    
44563132 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacggcggcattaacgggtacctga 44563033  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || | |||||||||||||||||    
44563032 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 44562936  T
195 catt 198  Q
    ||||    
44562935 catt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 9354653 - 9354453
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
9354653 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 9354554  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
9354553 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 9354457  T
195 catt 198  Q
    ||||    
9354456 catt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 19659223 - 19659423
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | || ||||| || ||| ||||  | | |||||| ||||||||||||    
19659223 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggttgttgttgcattcgctggacgacggcattaacgggtacctga 19659322  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   ||| | || | |||||||||||||||||    
19659323 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 19659419  T
195 catt 198  Q
    ||||    
19659420 catt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 19286459 - 19286265
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||||||||||||||| || ||||||||||| ||||| | |   || ||||| |||||||    
19286459 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcaatggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaa 19286360  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| ||||||||||||||  |||  ||  | |||| |||||| |  ||||| ||||| || || |||||||| ||||||||||||    
19286359 acggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggccatggattga 19286265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 31490013 - 31490165
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
31490013 gcaatcgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 31490112  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || ||||||||||||||||| ||||||    
31490113 atgacggaggcatttgagctgcattgataggggcaacagtagccattgattga 31490165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 19674390 - 19674238
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || || || ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
19674390 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 19674291  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||||||||||    
19674290 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattga 19674238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 28362218 - 28362370
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
28362218 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 28362317  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| ||||| ||||| |||||||||||||||    
28362318 atgacggaggcatttgagctgcattgatgggagcaacggtagccatggattga 28362370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 19688053 - 19687898
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||||||||| ||||| || |||||||||||||| || ||  ||   ||      
19688053 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctgggaatacggcgcatatg 19687954  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || |||||||| || || |||||||||||||||||||||    
19687953 ggtatgacggaggcatttgggcagcattgataggagcaacagtagccatggattga 19687898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 16277509 - 16277424
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
16277509 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 16277424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 27609165 - 27609250
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
27609165 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 27609250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 18710541 - 18710453
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    |||||||  ||||||||||| ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18710541 tgagcaactgcattgacgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18710453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 19208623 - 19208775
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
19208623 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 19208722  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
19208723 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 19208775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 33258675 - 33258524
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
33258675 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 33258576  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
33258575 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 33258524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 2137519 - 2137604
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||  || |||||||||||||||||    
2137519 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctgaga 2137604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 19518451 - 19518488
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||||||||| ||||||||||||||||||||    
19518451 tactgatgataaaatggcgggaagaaaggatgctgaga 19518488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 25)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 15391563 - 15391789
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||    
15391563 tggtatcggaggaaaggtaggtctggtttgttgctgctgttgttgagccagcggctgttgctgcatttgctgagcaatggcattgatgggtacctgaggt 15391662  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |    
15391663 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagctgagcaacattga 15391762  T
201 tgggggc-aacagtagccatggattga 226  Q
    ||||||| |||||||||||||||||||    
15391763 tgggggcaaacagtagccatggattga 15391789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 14235750 - 14235981
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg------agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    ||||||| |||||||||||||||| | |||||| |||||||||||      |||| |||||||||| || |||||||||||||||||||| |||||||||    
14235750 tggtatcagaggaaaggtaggtctagcttgttgttgctgctgttgttgctgagccggcggctgttgttgcatttgctgagcaatggcattaacgggtacc 14235849  T
95 tgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    |  || |||||||  | | | || ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || ||| |||||| ||||||||    
14235850 tatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgctgagagtattgcatatactggtacggcagaggtaactgagcag 14235949  T
195 cattaatgggggcaacagtagccatggattga 226  Q
    ||||||| |||| |||||| ||||||||||||    
14235950 cattaataggggtaacagtggccatggattga 14235981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 15285153 - 15285381
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   ||   | |||||||| || ||||||||| | |||||||| ||||| ||||||    
15285153 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagttggtggctgttgttgcatttgctgaacgatggcattaacgggcacctga 15285252  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||  | ||    ||||||| ||| |||||||    
15285253 ggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatatgggtacaatggaggtaactgggcagcat 15285352  T
198 taatgggggcaacagtagccatggattga 226  Q
    |||| ||||||||||||||||||||||||    
15285353 taataggggcaacagtagccatggattga 15285381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 15227916 - 15227688
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||||| | |  ||||| ||||||||||||    
15227916 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctgaacgacagcattaacgggtacctga 15227817  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   ||||| || ||||| |||||||| ||||| ||||||||||||||||||   ||| | || | |||||||| ||| ||||    
15227816 ggttgacccg---atggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaggtaactgggcag 15227720  T
195 cattaatgggggcaacagtagccatggattga 226  Q
    ||||||| ||||||||||||||||||||||||    
15227719 cattaataggggcaacagtagccatggattga 15227688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1900303 - 1900075
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg---ctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||| || ||   ||||||| |  | |||||||| || ||||||||| | | |||||| ||||||||||||    
1900303 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgctgttgaactggtggctgttgttgcatttgctgaacgacggcattaacgggtacctga 1900204  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| ||||    
1900203 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcag 1900107  T
195 cattaatgggggcaacagtagccatggattga 226  Q
    ||||||| ||||||||||||||||||||||||    
1900106 cattaataggggcaacagtagccatggattga 1900075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 5005837 - 5005685
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
5005837 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 5005738  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| ||||| ||||| |||||||||||||||    
5005737 atgacggaggcatttgagctgcattgatgggagcaacggtagccatggattga 5005685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 30753709 - 30753557
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
30753709 gcaattgcattgacgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 30753610  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
30753609 atgacggaggcatttgagctgcattgataggtgcaacagtagccatggattga 30753557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 21969671 - 21969516
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| || |||||||||||||||||||| ||  |||| ||      
21969671 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatg 21969572  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
21969571 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattga 21969516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 27163618 - 27163773
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
27163618 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 27163717  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
27163718 ggtatgacggaggcatttgagctgcattgatgggagcaacagtagccattgattga 27163773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 33674114 - 33674266
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||||||||||||||| ||||||||||||||  |||||||  | |    
33674114 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaatggtgggaagaacggatgctgagagtacggcatgtatgggt 33674213  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
33674214 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 33674266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 39850590 - 39850438
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
39850590 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 39850491  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
39850490 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattga 39850438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 54833399 - 54833205
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||||||||||||||| || ||||||||||| ||||| | |   || ||||| |||||||    
54833399 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcaatggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaa 54833300  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| ||||||||||||||  |||  ||  | |||| |||||| |  ||||| ||||| || || |||||||| ||||||||||||    
54833299 acggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggccatggattga 54833205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 24460830 - 24461030
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
24460830 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 24460929  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
24460930 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 24461026  T
195 catt 198  Q
    ||||    
24461027 catt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 24592612 - 24592767
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
24592612 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 24592711  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
24592712 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 24592767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 17013970 - 17013885
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
17013970 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 17013885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 14098463 - 14098356
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
14098463 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 14098364  T
219 tggattga 226  Q
    | ||||||    
14098363 ttgattga 14098356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 31126867 - 31126974
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
31126867 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31126966  T
219 tggattga 226  Q
    | ||||||    
31126967 ttgattga 31126974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 14664988 - 14664903
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
14664988 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 14664903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 14763605 - 14763693
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
14763605 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 14763693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 219
Target Start/End: Original strand, 18800971 - 18801071
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
18800971 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 18801070  T
219 t 219  Q
    |    
18801071 t 18801071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 24112635 - 24112547
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
24112635 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 24112547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 34189258 - 34189346
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
34189258 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 34189346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 40105942 - 40106094
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
40105942 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 40106041  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
40106042 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 40106094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 156
Target Start/End: Complemental strand, 6569820 - 6569738
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||| |||||||| |||||||||||||| |   | || ||||| || |||||||| || |||||||||||||||||    
6569820 gcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgaga 6569738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 159
Target Start/End: Complemental strand, 19373183 - 19373143
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| |||||||| ||||||||||| ||||||||||||||    
19373183 tactgatgataaaacggtgggaagaacggatgctgagagta 19373143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 21592 - 21367
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||| || ||||||||||||||||||||||||||||||||||||    
21592 tggtatcggaggaaaggtaggtctggtttgttgttgctgctgttaagccagcagctgttgttgcatttgctgagcaatggcattgacgggtacctgaggt 21493  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||| |    
21492 tgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgcatgtactggtacggcggaggtagctgagaagcattga 21393  T
201 tgggggcaacagtagccatggattga 226  Q
    |||||||||||||||||| |||||||    
21392 tgggggcaacagtagccacggattga 21367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 40)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 54 - 218
Target Start/End: Complemental strand, 27392961 - 27392797
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    ||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||    
27392961 gctgttgttgcatttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctg 27392862  T
154 agagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    |||||||||||||||||| || || |||||||||||||||||||  |||||||||||||||||||    
27392861 agagtattgcatgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagcca 27392797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 19456635 - 19456863
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||| | | |||||||| ||||| ||||||    
19456635 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctaaacgatggcattaacgggcacctga 19456734  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| |||||||| ||||||||||||||| ||||||||   ||  | || | |||||||| ||| |||||||    
19456735 ggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgaaagtattgcgcatatgggtacgacggaggtaactgggcagcat 19456834  T
198 taatgggggcaacagtagccatggattga 226  Q
    |||| ||||||||||||||||||||||||    
19456835 taataggggcaacagtagccatggattga 19456863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 31891542 - 31891742
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
31891542 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 31891641  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || | |||||||||||||||||    
31891642 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 31891738  T
195 catt 198  Q
    ||||    
31891739 catt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 21703378 - 21703606
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||| ||| | | |||||| ||||||||||||    
21703378 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgttgaacgacggcattaacgggtacctga 21703477  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||  ||||    
21703478 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactaggcag 21703574  T
195 cattaatgggggcaacagtagccatggattga 226  Q
    ||||||| ||||||||||||||||||||||||    
21703575 cattaataggggcaacagtagccatggattga 21703606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 2 - 198
Target Start/End: Complemental strand, 27118714 - 27118515
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||| ||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| |||||||||||||    
27118714 ggtatcggagggaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgag 27118615  T
99 gttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagc 195  Q
    |||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   | | | || | ||||||||||||||||||    
27118614 gttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatgcgggtacgacggaggtagctgagcagc 27118518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 32049749 - 32049594
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
32049749 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 32049650  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
32049649 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattga 32049594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 34157038 - 34156838
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
34157038 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 34156939  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
34156938 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 34156842  T
195 catt 198  Q
    ||||    
34156841 catt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 34303517 - 34303717
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||  | | | |||| ||||||||||||    
34303517 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacgacattaacgggtacctga 34303616  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
34303617 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 34303713  T
195 catt 198  Q
    ||||    
34303714 catt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 11635482 - 11635634
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
11635482 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 11635581  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||||||||||    
11635582 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattga 11635634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 11641671 - 11641823
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
11641671 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 11641770  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||||||||||    
11641771 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattga 11641823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 3784681 - 3784481
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  ||||||| |||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
3784681 tggtatcagaggaaaggtaggtctagcctgttgctactgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 3784582  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
3784581 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 3784485  T
195 catt 198  Q
    ||||    
3784484 catt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 16163626 - 16163426
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
16163626 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 16163527  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
16163526 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 16163430  T
195 catt 198  Q
    ||||    
16163429 catt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 261058 - 261210
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
261058 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 261157  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| ||||||    
261158 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattga 261210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 12586749 - 12586597
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  |||    
12586749 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatggat 12586650  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||||||||||    
12586649 atgacggaggcatttgagttgcattgataggagcaacagtagtcatggattga 12586597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 21677475 - 21677627
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
21677475 gcaatcgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 21677574  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||| |  ||||| ||||| || || |||||||||||||| ||||||    
21677575 atggcggaggcatttgagctgcattgataggagcaacagtagccattgattga 21677627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 34279400 - 34279245
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
34279400 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 34279301  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
34279300 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 34279245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 13936837 - 13936989
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||  | |    
13936837 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 13936936  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
13936937 atgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 13936989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 12716943 - 12717050
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
12716943 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 12717042  T
219 tggattga 226  Q
    ||||||||    
12717043 tggattga 12717050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 27434734 - 27434889
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |     || ||||| ||||| |||||||| ||||||||||||||||||||  ||   ||      
27434734 tgagcaattgcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatg 27434833  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | || | |||||| |  || ||||||||||| || |||||||||||||||||||||    
27434834 ggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattga 27434889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 27803640 - 27803488
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27803640 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27803541  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| ||||||    
27803540 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattga 27803488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 37925441 - 37925289
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37925441 gcaatcgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37925342  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
37925341 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 37925289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 40233447 - 40233295
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||| ||  | |    
40233447 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggt 40233348  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
40233347 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 40233295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 16829676 - 16829783
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||  ||||| ||||| ||||| |||||||    
16829676 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16829775  T
219 tggattga 226  Q
    ||||||||    
16829776 tggattga 16829783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 16891805 - 16891698
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||  ||||| ||||| ||||| |||||||    
16891805 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16891706  T
219 tggattga 226  Q
    ||||||||    
16891705 tggattga 16891698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 28882165 - 28882010
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
28882165 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 28882066  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
28882065 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 28882010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 12655493 - 12655408
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
12655493 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 12655408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 20837869 - 20837784
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
20837869 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 20837784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 23128856 - 23128941
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
23128856 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 23128941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 27392996 - 27392964
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttg 33  Q
    |||||||||||||||||||||||||||||||||    
27392996 tggtatcggaggaaaggtaggtctggtttgttg 27392964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 27777155 - 27777003
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||| || |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27777155 gcaattgcattgacgggcacttgaggttgacctggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27777056  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| ||||||    
27777055 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattga 27777003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 27816922 - 27816770
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||| || |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27816922 gcaattgcattgacgggcacttgaggttgacctggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27816823  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| ||||||    
27816822 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattga 27816770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 31876229 - 31876077
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31876229 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31876130  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
31876129 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 31876077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 34861628 - 34861476
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
34861628 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 34861529  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
34861528 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 34861476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 37686202 - 37686354
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37686202 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37686301  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
37686302 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 37686354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 37701467 - 37701619
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37701467 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37701566  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
37701567 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 37701619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 19416792 - 19416943
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
19416792 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 19416891  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
19416892 atgacggaggcatttgagccgcattgataggagcaacagtagccattgattg 19416943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 34286305 - 34286150
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||  ||||||||||||||  ||||||||||||| |   | || ||||| || |||||||| || |||||||||||||| || ||  |||| ||      
34286305 tgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatg 34286206  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||| ||||||||||||    
34286205 ggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattga 34286150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 34291365 - 34291210
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||  ||||||||||||||  ||||||||||||| |   | || ||||| || |||||||| || |||||||||||||| || ||  |||| ||      
34291365 tgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatg 34291266  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||| ||||||||||||    
34291265 ggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattga 34291210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 39889965 - 39889858
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||| ||||    
39889965 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggcca 39889866  T
219 tggattga 226  Q
    ||||||||    
39889865 tggattga 39889858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 39052121 - 39052206
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| || |||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
39052121 gcaattgcgttgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 39052206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16208256 - 16208481
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||| | |||||| || || |||||| |  | |||||||| || ||||||||| | |||||||| | ||||||||||||     
16208256 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgttgaactggtggctgttgttgcatttgctgaacgatggcattaatgggtacctgaggc 16208355  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||  | ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||||||    
16208356 tgacccgatggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtaactgggcagcattaa 16208455  T
201 tgggggcaacagtagccatggattga 226  Q
    | ||||||||||||||||||||||||    
16208456 taggggcaacagtagccatggattga 16208481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 54 - 226
Target Start/End: Complemental strand, 20461079 - 20460907
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    ||||||| || ||||||||| | |||||||| ||||||||||||||||||||||  | | | ||||| || ||||| |||||||| ||||||||||||||    
20461079 gctgttgttgcatttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctg 20460980  T
154 agagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||||||||||   ||| | || |||||||||| ||| ||||||||||| ||||||| ||||||||||||||||    
20460979 agagtattgcgcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattga 20460907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 20340560 - 20340760
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||| || ||||| |||||   |||  | |||||||| || ||||| ||| | | |||||||||||||||||||    
20340560 tggtatcggaggaaaggtaggtctagcttgctgatgctgttgttgttgagctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctga 20340659  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||  |||| | || | |||||||||||||||||    
20340660 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcgtacgggtacgacggaggtagctgagcag 20340756  T
195 catt 198  Q
    ||||    
20340757 catt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 72 - 226
Target Start/End: Original strand, 41793610 - 41793764
Alignment:
72 gagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactg 171  Q
    ||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||| ||||| ||  |||| ||  |    
41793610 gagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgg 41793709  T
172 atatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
     |||| |||||| |  || || ||||| || || ||||| |||||||||||||||    
41793710 gtatgacggaggcatttgggctgcattgataggagcaacggtagccatggattga 41793764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 28584932 - 28584781
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||| | |    
28584932 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggt 28584833  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
28584832 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 28584781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 10962621 - 10962469
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
10962621 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 10962522  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
10962521 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 10962469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 51638124 - 51638017
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
51638124 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 51638025  T
219 tggattga 226  Q
    | ||||||    
51638024 ttgattga 51638017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 28)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 2 - 226
Target Start/End: Complemental strand, 20160728 - 20160501
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||||||||||||||| ||||||||||| || |||||   |||  | |||||||||||| ||||||||||||||||||| |||||||||||||    
20160728 ggtatcggaggaaaggtaggtctagtttgttgctgttgttgttgttgagctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgag 20160629  T
99 gttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcatt 198  Q
    |||||||||| | | | |||||||| || |||||||||||  |||||||||| |||||||| ||     || | ||||| |||||||  |||| ||||||    
20160628 gttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcatt 20160529  T
199 aatgggggcaacagtagccatggattga 226  Q
    ||  ||||||||||||||||||||||||    
20160528 aacaggggcaacagtagccatggattga 20160501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 22172103 - 22172330
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||||||||||||||| ||||||||||| || |||||   |||  | |||||||||||| ||||||||||||||||||| |||||||||||||    
22172103 ggtatcggaggaaaggtaggtctagtttgttgctgttgttgttgttgagctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgag 22172202  T
99 gttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcatt 198  Q
    |||||||||| | | | |||||||| || |||||||||||  |||||||||| |||||||| ||     || | ||||| |||||||  |||| ||||||    
22172203 gttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcatt 22172302  T
199 aatgggggcaacagtagccatggattga 226  Q
    ||  ||||||||||||||||||||||||    
22172303 aacaggggcaacagtagccatggattga 22172330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 28162685 - 28162485
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
28162685 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 28162586  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || |  ||||||||||||||||    
28162585 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgatggaggtagctgagcag 28162489  T
195 catt 198  Q
    ||||    
28162488 catt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 22477441 - 22477672
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc------tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    ||||||| |||||||||||||||| | ||||||||| ||       |||||| || | | |||||| || ||||| |||||||| ||||| |||||||||    
22477441 tggtatcagaggaaaggtaggtctagcttgttgctgttgtcgttgttgttgaaccggtgactgttgttgcatttgttgagcaattgcattaacgggtacc 22477540  T
95 tgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgag 191  Q
    |||||||||||||   |||||   |||||||  ||||| |||||||| ||||| |||||||||||||| |||   ||| | || | | ||||||  || |    
22477541 tgaggttgacccg---atggcaaaggatactaatgatagaatggtggaaagaagggatgctgagagtactgcgcatacgggtacgacagaggtaattggg 22477637  T
192 cagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||| ||||||||||||||||||||||||    
22477638 cagcattaattggggcaacagtagccatggattga 22477672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 8892478 - 8892678
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
8892478 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 8892577  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
8892578 ggttgacc---cgatggcaaagaatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 8892674  T
195 catt 198  Q
    ||||    
8892675 catt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13522241 - 13522441
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13522241 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13522340  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13522341 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13522437  T
195 catt 198  Q
    ||||    
13522438 catt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 33374424 - 33374624
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
33374424 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 33374523  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
33374524 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 33374620  T
195 catt 198  Q
    ||||    
33374621 catt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 26918332 - 26918177
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
26918332 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26918233  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
26918232 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 26918177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 8903713 - 8903913
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
8903713 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 8903812  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| |||||  |||||||||||||||||   |||   || | |||||||||||||||||    
8903813 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagagatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 8903909  T
195 catt 198  Q
    ||||    
8903910 catt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 3696012 - 3695860
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
3696012 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 3695913  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
3695912 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 3695860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 34463608 - 34463760
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
34463608 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 34463707  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||| ||| ||||||    
34463708 atgacggaggcatttgagctgcattgataggagcaacagtagtcattgattga 34463760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 27000025 - 26999870
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
27000025 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26999926  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
26999925 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 26999870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 30558308 - 30558415
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
30558308 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 30558407  T
219 tggattga 226  Q
    ||||||||    
30558408 tggattga 30558415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 4525280 - 4525086
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||| ||||||||||| || ||||||||||| || || |     |||||||| |||||||    
4525280 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcgatggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaa 4525181  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
4525180 acggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagccatagattga 4525086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 16674076 - 16673924
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||| ||  |||    
16674076 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatggat 16673977  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||| || ||||||    
16673976 atgacggaggcatttgagctgcattgataggagcaacggtagctattgattga 16673924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 26988953 - 26988798
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
26988953 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26988854  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
26988853 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 26988798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 13299195 - 13299280
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
13299195 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 13299280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 15424561 - 15424646
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
15424561 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 15424646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 16749806 - 16749721
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
16749806 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 16749721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 22935121 - 22935158
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| |||||||||||||||||||||||||||||    
22935121 tgagcaattgcattgacgggtacctgaggttgacccgg 22935158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 23857566 - 23857603
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| |||||||||||||||||||||||||||||    
23857566 tgagcaattgcattgacgggtacctgaggttgacccgg 23857603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 29549430 - 29549342
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
29549430 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 29549342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 29572962 - 29572810
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
29572962 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 29572863  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
29572862 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 29572810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 16944274 - 16944425
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
16944274 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 16944373  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
16944374 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 16944425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 24304862 - 24305017
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| ||||||||||| ||  |||  ||      
24304862 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatg 24304961  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || |||||||| || || || ||||||||||||||||||    
24304962 ggtatgacggaggcatttgggcagcattgataggagcgacagtagccatggattga 24305017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 27007616 - 27007509
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
27007616 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatataggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 27007517  T
219 tggattga 226  Q
    | ||||||    
27007516 ttgattga 27007509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 26777919 - 26778025
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |||| |||||| |  || || | ||| || || |||||||||||||    
26777919 tactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggcatttgggctgtattgataggtgcaacagtagcca 26778018  T
219 tggattg 225  Q
    | |||||    
26778019 ttgattg 26778025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 24863669 - 24863584
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| ||||| |||||||| || ||||||| ||| | | | || ||||| ||||| ||||| || |||||||||||||||||    
24863669 tgagcaattgcattaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgaga 24863584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 42)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16626772 - 16627000
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||||| | |||||||| ||||||||| ||    
16626772 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctgaacgatggcattaacgggtaccgga 16626871  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| || ||||| ||||| |||||||||||||||||    ||| | || | |||||||| ||| |||||||    
16626872 ggttgacccgatggtagaggatactgatgatagaacggtggaaagaagggatgctgagagtattgtgcatacgggtacgacggaggtaactgggcagcat 16626971  T
198 taatgggggcaacagtagccatggattga 226  Q
    |||| ||||||||||||||||||||||||    
16626972 taataggggcaacagtagccatggattga 16627000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 18530380 - 18530158
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||| | ||||||||||||   ||||||  | |||||||| || ||||||||| | | |||||| ||||| || ||||||    
18530380 tggtatcggaggaaaggtaggtctagcttgttgctgctg---ttgagctggtggctgttgttgcatttgctgaacgacggcattaacgggcacttgaggt 18530284  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || |  ||||||| ||| ||||||||||    
18530283 tgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgatggaggtaactgggcagcattaa 18530184  T
201 tgggggcaacagtagccatggattga 226  Q
    | |||| |||||||||||||||||||    
18530183 taggggtaacagtagccatggattga 18530158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 7996478 - 7996323
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
7996478 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 7996379  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
7996378 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattga 7996323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 10642986 - 10642831
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
10642986 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 10642887  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
10642886 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattga 10642831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 17994050 - 17994250
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
17994050 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 17994149  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
17994150 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 17994246  T
195 catt 198  Q
    ||||    
17994247 catt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 28116302 - 28116454
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
28116302 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 28116401  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||||||||||    
28116402 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattga 28116454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 47023366 - 47023214
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| ||||||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
47023366 gcaattgcattgacgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 47023267  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| ||||||    
47023266 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattga 47023214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 4625936 - 4625736
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | | |||| ||||||||||||    
4625936 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacgacattaacgggtacctga 4625837  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
4625836 ggttgacccg---atggcaaaggatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 4625740  T
195 catt 198  Q
    ||||    
4625739 catt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 11110706 - 11110858
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
11110706 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 11110805  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || ||||| |||||||||||||||    
11110806 atgacggaggcatttgagttgcattgataggagcaacggtagccatggattga 11110858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 51781924 - 51781772
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
51781924 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 51781825  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
51781824 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 51781772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 51797013 - 51796861
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
51797013 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 51796914  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
51796913 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 51796861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 4721547 - 4721392
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||| |||||||||| ||  |||  ||      
4721547 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatg 4721448  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
4721447 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 4721392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 7073128 - 7072973
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
7073128 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 7073029  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
7073028 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 7072973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 5652379 - 5652179
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
5652379 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 5652280  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||| ||    ||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
5652279 ggttgacc---cgattgcaaacgatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 5652183  T
195 catt 198  Q
    ||||    
5652182 catt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 20577207 - 20577359
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
20577207 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 20577306  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| ||||||    
20577307 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattga 20577359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 29665330 - 29665482
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||  |||||||  | |    
29665330 gcaattgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 29665429  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
29665430 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 29665482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 36997434 - 36997586
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| ||||||||||| || || |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
36997434 gcaattgcattgacgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 36997533  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
36997534 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 36997586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 4796995 - 4797150
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
4796995 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 4797094  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
4797095 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 4797150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 6192232 - 6192077
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||  ||||||||||| |  ||||||||||||||||| ||  |||  ||      
6192232 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatg 6192133  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
6192132 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 6192077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 17985346 - 17985453
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
17985346 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 17985445  T
219 tggattga 226  Q
    ||||||||    
17985446 tggattga 17985453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 35880682 - 35880527
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
35880682 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 35880583  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
35880582 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 35880527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Complemental strand, 5713134 - 5713016
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5713134 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5713035  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5713034 gaggtagctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Complemental strand, 5724044 - 5723926
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5724044 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5723945  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5723944 gaggtagctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 5757433 - 5757551
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5757433 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5757532  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5757533 gaggtagctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 5768324 - 5768442
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5768324 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5768423  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5768424 gaggtagctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 8211696 - 8211502
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||    
8211696 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaa 8211597  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | ||||||||||| ||||||||||||||  ||   ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
8211596 acggtgggaagaacggatgctgagagtacggcgcatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 8211502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 74 - 159
Target Start/End: Complemental strand, 48465828 - 48465743
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |  || || ||||| || ||||| ||||||||||| ||||||||||||||    
48465828 gcaattgcattgacgggcacttgaggttgacccggtggcggggggtactgatggtaaaacggtgggaagaacggatgctgagagta 48465743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 5013625 - 5013473
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
5013625 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 5013526  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
5013525 atgacggaggcatttgagctgcattgatgggagcaacagtagccattgattga 5013473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 18225104 - 18224952
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
18225104 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 18225005  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
18225004 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 18224952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 5466853 - 5466746
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||||||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
5466853 tactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 5466754  T
219 tggattga 226  Q
    | ||||||    
5466753 tagattga 5466746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 15741424 - 15741579
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
15741424 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 15741523  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
15741524 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 15741579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 22871264 - 22871371
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| | |||||| ||||| || || |||||||||||||    
22871264 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22871363  T
219 tggattga 226  Q
    | ||||||    
22871364 tagattga 22871371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 22886323 - 22886430
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| | |||||| ||||| || || |||||||||||||    
22886323 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22886422  T
219 tggattga 226  Q
    | ||||||    
22886423 tagattga 22886430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 8295891 - 8295806
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| || ||||| |||||||||||||| ||  | || ||||| ||||||||||| || |||||||||||||||||    
8295891 tgagcgattgcattaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgaga 8295806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 4893129 - 4893041
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
4893129 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 4893041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18277394 - 18277482
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18277394 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18277482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18292695 - 18292783
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18292695 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18292783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18307996 - 18308084
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18307996 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18308084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 32439073 - 32438985
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
32439073 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 32438985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 6542864 - 6542971
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
6542864 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 6542963  T
219 tggattga 226  Q
    | ||||||    
6542964 ttgattga 6542971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 24328072 - 24327921
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
24328072 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 24327973  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
24327972 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 24327921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 29149145 - 29149182
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| |||||||| |||||||||||||||||||||||    
29149145 tactgatgataaaacggtgggaagaaaggatgctgaga 29149182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 23)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16450109 - 16450337
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg---ctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||||||||||||   |||||||||  | |||||||| || | ||||||| | | |||||| | ||||||||||    
16450109 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgctgttgagctggtggctgttgttgcacttgctgaacgacggcattaatgggtacctga 16450208  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| |||||||||||||| ||||| |||||||||||||| |||  |||| | || | |||||||| ||| ||||    
16450209 ggttgacccg---atggcaaaggatactgatgataaaatggtggaaagaagggatgctgagagtactgcgcgtacgggtacgacggaggtaactgggcag 16450305  T
195 cattaatgggggcaacagtagccatggattga 226  Q
    ||||||| |||||||||||||| |||||||||    
16450306 cattaataggggcaacagtagctatggattga 16450337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 16041355 - 16041127
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | || ||| ||||||||||||    
16041355 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggaattaacgggtacctga 16041256  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  ||    |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| |||||||    
16041255 ggttgacccgatgacaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcagcat 16041156  T
198 taatgggggcaacagtagccatggattga 226  Q
    |||| ||||||||||||||||||||||||    
16041155 taataggggcaacagtagccatggattga 16041127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 31088575 - 31088775
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
31088575 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 31088674  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
31088675 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 31088771  T
195 catt 198  Q
    ||||    
31088772 catt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 45733492 - 45733292
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
45733492 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 45733393  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
45733392 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 45733296  T
195 catt 198  Q
    ||||    
45733295 catt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 3445247 - 3445095
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
3445247 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 3445148  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
3445147 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 3445095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 5147530 - 5147682
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||||||  |||| ||  |||    
5147530 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggat 5147629  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||  |||||||||||||||    
5147630 atgacggaggcatttgagctgcattgataggagcaatggtagccatggattga 5147682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 5127948 - 5127793
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | |||||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
5127948 tgagcaattgcattaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 5127849  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
5127848 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 5127793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 16503567 - 16503722
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| ||||||||||||||||||||||| |     |||||||| ||||| ||||| || ||||||||||||||||||||  ||   ||      
16503567 tgagcaattgcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatg 16503666  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || ||||||||||| || |||||||||||||||||||||    
16503667 ggtatgacggaggcatttgggcagcattaataggagcaacagtagccatggattga 16503722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 16518603 - 16518758
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| ||||||||||||||||||||||| |     |||||||| ||||| ||||| || ||||||||||||||||||||  ||   ||      
16518603 tgagcaattgcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatg 16518702  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || ||||||||||| || |||||||||||||||||||||    
16518703 ggtatgacggaggcatttgggcagcattaataggagcaacagtagccatggattga 16518758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 11441513 - 11441361
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
11441513 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 11441414  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
11441413 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 11441361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 45387296 - 45387144
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
45387296 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 45387197  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
45387196 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 45387144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 74 - 159
Target Start/End: Complemental strand, 26435210 - 26435125
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||||||    
26435210 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagta 26435125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 226
Target Start/End: Complemental strand, 2154559 - 2154374
Alignment:
41 tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtggga 140  Q
    |||||| |||||  |||||| | ||| || |||||||| ||||| |||| ||| |||||||||||||| |   | || ||||| ||||||||||| || |    
2154559 tgttgaaccagcaactgttgttttatctgttgagcaattgcattaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaa 2154460  T
141 agaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||||||||| ||  |||  ||  | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
2154459 agaaaggatgctgagaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 2154374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 4145310 - 4145465
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||      
4145310 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatg 4145409  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
4145410 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 4145465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 26485934 - 26486019
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
26485934 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 26486019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 26538063 - 26538148
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
26538063 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 26538148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 5159478 - 5159390
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
5159478 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 5159390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 9618604 - 9618452
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
9618604 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 9618505  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
9618504 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 9618452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 24592731 - 24592883
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
24592731 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 24592830  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
24592831 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 24592883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 26275284 - 26275436
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26275284 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26275383  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
26275384 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 26275436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 26320059 - 26320211
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26320059 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26320158  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
26320159 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 26320211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 11424963 - 11425118
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
11424963 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 11425062  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || ||  |||| || || |||||||||||||||||||||    
11425063 ggtatgacggaggcatttgggctacattgataggagcaacagtagccatggattga 11425118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 10917052 - 10917137
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| || ||||| |||||||||||||| |   | |||||||| ||||||||||| || ||||| |||||||||||    
10917052 tgagcgattgcattaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctgaga 10917137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 2883 - 3083
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||| || ||||| |||||   |||  | |||||||| || ||||| ||| | | |||||||||||||||||||    
2883 tggtatcggaggaaaggtaggtctagcttgctgatgctgttgttgttgagctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctga 2982  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||  |||| | || | |||||||||||||||||    
2983 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcgtacgggtacgacggaggtagctgagcag 3079  T
195 catt 198  Q
    ||||    
3080 catt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 41)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 22888510 - 22888287
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | |||||| |||| |||||||    
22888510 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggcattaacggttacctga 22888411  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| ||||    
22888410 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcag 22888314  T
195 cattaatgggggcaacagtagccatgg 221  Q
    ||||||| |||||||||||||||||||    
22888313 cattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 23892246 - 23892015
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg------agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    |||||||||||||||||||||||| | |||||| || || |||||      | || | |||||||| || ||||||||| | ||||||||||||||||||    
23892246 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgttgttgttgaaccggtggctgttgttgcatttgctgaacgatggcattgacgggtacc 23892147  T
95 tgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgag 191  Q
    |||||||||||||   |||||   |||||||| ||||| |||| ||| ||||||||||||||||||||  ||   ||  | || | |||||| |  || |    
23892146 tgaggttgacccg---atggcaaaggatactgatgatagaatgttggaaagaaaggatgctgagagtacggcgcatatgggtacgacggaggcatttggg 23892050  T
192 cagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||| || |||||||||||||||||||||    
23892049 cagcattaataggagcaacagtagccatggattga 23892015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13184770 - 13184970
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13184770 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13184869  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13184870 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13184966  T
195 catt 198  Q
    ||||    
13184967 catt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13440616 - 13440816
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13440616 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13440715  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13440716 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13440812  T
195 catt 198  Q
    ||||    
13440813 catt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 33877287 - 33877087
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
33877287 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 33877188  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
33877187 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 33877091  T
195 catt 198  Q
    ||||    
33877090 catt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 8665676 - 8665828
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| ||  | || ||||| ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
8665676 gcaatcgcattgacgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 8665775  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||| |  ||||| ||||| || || |||||||||||||| ||||||    
8665776 atggcggaggcatttgagctgcattgataggagcaacagtagccattgattga 8665828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 2 - 156
Target Start/End: Complemental strand, 24970057 - 24969903
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggtt 101  Q
    ||||||||||| || |||||||| | |||||| || || |||||| || || ||||||| |  || || |||||||| ||||| ||||||||||||||||    
24970057 ggtatcggagggaaagtaggtctagcttgttgatgttgttgttgaaccggcagctgttgtttcatctgttgagcaattgcattaacgggtacctgaggtt 24969958  T
102 gacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||||| |     |||||||| ||||| ||||| || |||||||||||||||||    
24969957 gacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgaga 24969903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 11325834 - 11325634
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
11325834 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 11325735  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| |||    |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
11325734 ggttgtccca---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 11325638  T
195 catt 198  Q
    ||||    
11325637 catt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 18500949 - 18501101
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
18500949 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 18501048  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| ||||||    
18501049 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattga 18501101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 30168430 - 30168278
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
30168430 gcaattgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 30168331  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| ||||| |||| ||||||||||||||||    
30168330 atgacggaggcatttgagctgcattgatgggagcaatagtagccatggattga 30168278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 25199069 - 25198908
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||||||| |||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | ||| || ||| ||||||||    
25199069 tggtatcggagaaaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggcgttaacgagtacctga 25198970  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||    
25198969 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagta 25198908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 74 - 219
Target Start/End: Complemental strand, 43078210 - 43078065
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
43078210 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 43078111  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccat 219  Q
    | | |||||| |  ||||| ||||| || || ||||||||||||||    
43078110 acgacggaggcatttgagctgcattgataggtgcaacagtagccat 43078065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 218
Target Start/End: Complemental strand, 31431389 - 31431245
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31431389 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31431290  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||    
31431289 atgacggaggcatttgagctgcattgataggagcaacagtagcca 31431245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 18375658 - 18375765
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| |||||||||||||    
18375658 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 18375757  T
219 tggattga 226  Q
    | ||||||    
18375758 ttgattga 18375765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 22999312 - 22999467
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| ||||||||||||||||   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
22999312 tgagcgattgcattaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 22999411  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
22999412 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 22999467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 24681353 - 24681246
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
24681353 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24681254  T
219 tggattga 226  Q
    ||||||||    
24681253 tggattga 24681246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 24723880 - 24723773
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
24723880 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24723781  T
219 tggattga 226  Q
    ||||||||    
24723780 tggattga 24723773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 33516272 - 33516165
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
33516272 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagccgcattgatgggagcaacggtagcca 33516173  T
219 tggattga 226  Q
    ||||||||    
33516172 tggattga 33516165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 33777451 - 33777296
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
33777451 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 33777352  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
33777351 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 33777296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 9548741 - 9548826
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| || |||||||| || |||||||||||||||||    
9548741 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgaga 9548826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 30151979 - 30151827
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
30151979 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 30151880  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| ||||| |||||||||||||| ||||||    
30151879 atgacggaggcatttgagctgcattgatgggagcaacagtagccattgattga 30151827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 37754929 - 37754777
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37754929 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 37754830  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
37754829 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattga 37754777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 40473753 - 40473905
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| || |||||||| || ||||| || |||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  ||||||   | |    
40473753 gcaattgcgttgacgggcacttgaggctggcccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtgtgggt 40473852  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || ||||||||||||||||| ||||||    
40473853 atgacggaggcatttgagctgcattgataggggcaacagtagccattgattga 40473905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 11549318 - 11549163
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| |||||||||||||| |||||||||||||| || ||  |||  ||      
11549318 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctgtgaatacggcacatatg 11549219  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
11549218 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 11549163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 23718186 - 23718341
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
23718186 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 23718285  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
23718286 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 23718341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 23752648 - 23752803
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
23752648 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 23752747  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  || || ||||| || || |||||||||||||||||||||    
23752748 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattga 23752803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 159
Target Start/End: Complemental strand, 33292535 - 33292404
Alignment:
28 ttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtga 127  Q
    ||||||||||||||||||| |  |||| || || || |  || ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||    
33292535 ttgttgctgctgctgttgaactggcggttgatgttgcacctgttgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatga 33292436  T
128 taaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| ||||||||||||||    
33292435 taaaacggtgggaagaacggatgctgagagta 33292404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 3789487 - 3789335
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| |||||||| || ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||  |||| ||  | |    
3789487 gcaattgcattgacgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggt 3789388  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| ||||||    
3789387 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattga 3789335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 5637871 - 5637719
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
5637871 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 5637772  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
5637771 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 5637719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 9317412 - 9317260
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
9317412 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 9317313  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
9317312 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 9317260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 12132116 - 12131964
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
12132116 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 12132017  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
12132016 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 12131964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 15759058 - 15759210
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
15759058 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 15759157  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
15759158 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 15759210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 26480353 - 26480201
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26480353 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26480254  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
26480253 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 26480201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 31826620 - 31826772
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31826620 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31826719  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
31826720 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 31826772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 37771200 - 37771352
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37771200 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 37771299  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | | |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
37771300 acgacggaggcatttgagctgcattgataggtgcaacagtagccattgattga 37771352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 15658958 - 15659113
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| || || ||||||||||||||||| ||  |||  ||      
15658958 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatg 15659057  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    |||||| |||||| |  ||||  ||||| || || |||||||||||||| ||||||    
15659058 gatatgacggaggcatttgagttgcattgataggagcaacagtagccattgattga 15659113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 29967267 - 29967418
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
29967267 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 29967366  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
29967367 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 29967418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 30029376 - 30029225
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
30029376 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 30029277  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
30029276 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 30029225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 28649142 - 28649105
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||||||||| ||||||||||||||||||||    
28649142 tactgatgataaaatggcgggaagaaaggatgctgaga 28649105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 30934600 - 30934515
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| |||||||||||    
30934600 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgaga 30934515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 155
Target Start/End: Complemental strand, 41674670 - 41674589
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgag 155  Q
    ||||| |||||||||||||| |||||| ||||||| |   | || ||||| || |||||||| || ||||||||||||||||    
41674670 gcaattgcattgacgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgag 41674589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 54 - 226
Target Start/End: Complemental strand, 20384 - 20212
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatg 150  Q
    ||||||| || ||||||||| | | |||||| ||||||||||||||||||||||   |||||   |||||||| ||||| |||| ||| ||||| |||||    
20384 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccg---atggcaaaggatactgatgatagaatgatggaaagaagggatg 20288  T
151 ctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    |||||||||| ||   ||  | || | |||||||| ||| ||||||||||| ||||||||||||||||||||||||    
20287 ctgagagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattga 20212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 30408 - 30323
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| |||||||||||    
30408 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgaga 30323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 71 - 226
Target Start/End: Original strand, 431 - 586
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
431 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 530  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||||||||||    
531 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattga 586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 15279 - 15386
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| |||||||||||||    
15279 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 15378  T
219 tggattga 226  Q
    | ||||||    
15379 ttgattga 15386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 27247 - 27162
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| | | | || ||||| ||||||||||| || |||||||||||||||||    
27247 tgagcgattgcattaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctgaga 27162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 37 - 189
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 136  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
137 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattga 189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 26506 - 26658
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||    ||| ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26506 gcaattgcattgacgggcacttgaggctggcccggcggcaacgggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26605  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
26606 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 26658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 47286 - 47371
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
47286 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 47371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 40370 - 40407
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| ||||| |||||||||||||||||||||||    
40370 tgagcaattgcatttacgggtacctgaggttgacccgg 40407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 219
Target Start/End: Complemental strand, 5936 - 5796
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaat-ggtgggaagaaaggatgctgagagtattgcatgtactgatatggc 178  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||||||  ||||||||||||||||||||||| ||  |||||||  | |||| |    
5936 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgac 5837  T
179 ggaggtagctgagcagcattaatgggggcaacagtagccat 219  Q
    ||||| |  ||||  ||||| || || ||||||||||||||    
5836 ggaggcatttgagttgcattgataggagcaacagtagccat 5796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 7543 - 7695
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
7543 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 7642  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattga 226  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| ||||||    
7643 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattga 7695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 218
Target Start/End: Complemental strand, 8187 - 8040
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| ||||||||||| || ||||||||||| || || |     |||||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||      
8187 tgagcgatggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatg 8088  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||    
8087 ggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 8040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 253 - 291
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg 39  Q
    |||||||||||||||||||||||| | ||||||||||||    
253 tggtatcggaggaaaggtaggtctagcttgttgctgctg 291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University