View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_391 (Length: 226)
Name: NF6876A_low_391
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_391 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 10 - 158
Target Start/End: Original strand, 24881253 - 24881401
Alignment:
| Q |
10 |
agatggacatccttagccaccttttcttatcactgcaccatgcaaaacatgccaaaagaaatacatacacttaggtcaattttacggctgaaaaatggaa |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24881253 |
agatggacatctttagccaccttttcttatcactgcaccatgcaaaacataccaaaagaaatacatacacttaggtcaattttatggctgaaaaatggaa |
24881352 |
T |
 |
| Q |
110 |
actgttatgaagaatttgcttcagcaaagtgacaggttgacctgctact |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24881353 |
actgttatgaagaatttgcttcagcaaagtgacaggttgacctgctact |
24881401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 152 - 217
Target Start/End: Original strand, 24881441 - 24881506
Alignment:
| Q |
152 |
tgctactcatgattttaaatgaacttgaatttgtaaaatagtttggaaatgatattgttggacatg |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
24881441 |
tgctaatcatgattttaaatgaacttgaatttgtaaaatagtttggaaatgatttgcttggacatg |
24881506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University