View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_392 (Length: 225)
Name: NF6876A_low_392
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_392 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 31097628 - 31097404
Alignment:
| Q |
1 |
ggtggctggtctaatagtaatgatatttttatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgataaagnnnnnn |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097628 |
ggtggctggtttaatagtaatgatatttttatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgataaagtttttt |
31097529 |
T |
|
| Q |
101 |
nnacttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatcatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097528 |
ttacttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatcatga |
31097429 |
T |
|
| Q |
201 |
tcagttgattgtgtggaactaatga |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31097428 |
tcagttgattgtgtggaactaatga |
31097404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University