View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_407 (Length: 223)
Name: NF6876A_low_407
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_407 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10079069 - 10078847
Alignment:
| Q |
1 |
tcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcggcttcaccagaaacagatgcctgctgttgttgcatggaaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10079069 |
tcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcagcttcaccagaaacagatgcctgctgttgttgcatggaaatatt |
10078970 |
T |
 |
| Q |
101 |
agctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgtgggttgttgttagatgaggacggggttggtgaatgaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10078969 |
agctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgcgggttgttgttagatgaggacggtgttggtgaatgaaaa |
10078870 |
T |
 |
| Q |
201 |
ggggacgagtttggttgtgcctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10078869 |
ggggacgagtttggttgtgcctg |
10078847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University