View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_408 (Length: 223)
Name: NF6876A_low_408
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_408 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 27 - 223
Target Start/End: Original strand, 31079091 - 31079287
Alignment:
| Q |
27 |
atactcacgaggaagttatttactctagctttaattagttttcactgttaaacatgcactaaatatgtggatctcaagttgaggctattgaaaattgagg |
126 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31079091 |
atactcacgaggacgttatttactctagctttaattagttttcactgttaaacatgcactaaatatgtggatctcaagttgaagctattgaaaattgagg |
31079190 |
T |
 |
| Q |
127 |
agcttggtgcagaagaagtgtatgttggagcaaactcgtgtcgatgcatctttccttcccctcatgtataatgtttgattatagctttcaaataata |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079191 |
agcttggtgcagaagaagtgtatgttggagcaaactcgtgtcgatgcatctttccttcccctcatgtataatgtttgattatagctttcaaataata |
31079287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University