View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_419 (Length: 220)
Name: NF6876A_low_419
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_419 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 25967487 - 25967682
Alignment:
| Q |
15 |
gacatcatatgaaaaaatattaatatatgatcaatcaaattacttatcaaactagc-------acttattaattattattctaattggactttatgtata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25967487 |
gacatcatatgaaaaaatattaatatatgatcaatcaaattacttatcaaactagccgaagttacttattaattattattctaattggactttatgtata |
25967586 |
T |
|
| Q |
108 |
tgaacgggtaattaaaaattcccacgtgatttattaaaataaaaattccacatgcaagacaaattaatttcatctctttttcgttgatattgttgg |
203 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25967587 |
tgaacatgtaattaaaaattcccacgtgatttattaaaataaaaattccacatgcaagacaaattaattttatctctttttcgttgattttgttgg |
25967682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University