View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_425 (Length: 219)
Name: NF6876A_low_425
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_425 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 22 - 202
Target Start/End: Original strand, 39127101 - 39127281
Alignment:
| Q |
22 |
tagtgagagtcaatttgcctcaatactctcttccaaaggtcaaatttcaaggcaaaacggtcatatgcgattgaggtgtcaatggaagatcagaaaaggg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39127101 |
tagtgagagtcaatttgcctcaatactctcttccaaaggtcaaatttcaaggcaaaacggtcatatgcgattgaggtgtcaatggaagatcagaaaaggg |
39127200 |
T |
|
| Q |
122 |
tcaagttgtgaatgaagcaagtagtactgctatgatcttggcaaacacagagcttaacttggaagaagattcaattgatgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39127201 |
tcaagttgtgaatgaagcaagtagtactgctatgatcttggcaaacacagagcttaacttggaagaagattcaattgatgt |
39127281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 48 - 209
Target Start/End: Complemental strand, 39480298 - 39480137
Alignment:
| Q |
48 |
tctcttccaaaggtcaaatttcaaggcaaaacggtcatatgcgattgaggtgtcaatggaagatcagaaaagggtcaagttgtgaatgaagcaagtagta |
147 |
Q |
| |
|
||||||||||||| |||| ||||||| |||| ||| |||| ||| |||||||||| |||||||||||||||||||||| |||||| |||||| || || |
|
|
| T |
39480298 |
tctcttccaaaggacaaagttcaaggaaaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggtggtg |
39480199 |
T |
|
| Q |
148 |
ctgctatgatcttggcaaacacagagcttaacttggaagaagattcaattgatgtccatctc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
39480198 |
ctgctatgatcttggcaaacacagagctaaacttggaagaagattcggttgatgttcatctc |
39480137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University