View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_434 (Length: 215)
Name: NF6876A_low_434
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_434 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 25 - 203
Target Start/End: Original strand, 48399477 - 48399655
Alignment:
| Q |
25 |
ctccaaacaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat |
124 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399477 |
ctccaagcaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat |
48399576 |
T |
|
| Q |
125 |
tatggttaaattatctagctaacgatattttaaagtcttatatgttatgtcatnnnnnnngtcgtttcaaacaccaaac |
203 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
48399577 |
tatggttaaattatttaactaatgatattttaaagtcttatatgttatgtcataaaaaaagtcgtttcaaacacgaaac |
48399655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University