View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_437 (Length: 214)
Name: NF6876A_low_437
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_437 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 49133128 - 49133324
Alignment:
| Q |
18 |
gatggtggtcatcatgaaggaagaggcatgcctgagaatgttgatggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatg |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133128 |
gatggtggtcatcatgaaggaaaaggcatgcctgagaatattgatggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatg |
49133227 |
T |
 |
| Q |
118 |
ttctgtaacattttatcattgttcttcaccagatttagctgtgtgtctatccattactttacttgatccaaagttggtgaacaattttcatcattga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133228 |
ttctgtaacattttatcattgttcttcaccagatttagctgtgtgtctatccattactttacttgatccaaagttggtgaacaattttcatcattga |
49133324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University