View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_450 (Length: 206)
Name: NF6876A_low_450
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_450 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 3923887 - 3923726
Alignment:
| Q |
20 |
agaaacttcatcaaccacacgtaaactctatttcttacaatgtgacttcccactctatctataacaaaattacaattgcaaatgcatagatgaggaacca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923887 |
agaaacttcatcaaccacacgtaaactctatttcttacaatgtgacttcccactctatctataacaaaattacaattgcaaatgcatagatgaggaacca |
3923788 |
T |
|
| Q |
120 |
tccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatctttcat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923787 |
tccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatctttcat |
3923726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 174
Target Start/End: Original strand, 7421245 - 7421304
Alignment:
| Q |
115 |
aaccatccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcat |
174 |
Q |
| |
|
||||| ||||||||||| |||| |||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
7421245 |
aaccacccaaataccatgatgtgatattttggaagaaaattagaattcaaccaccagcat |
7421304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 14202065 - 14202120
Alignment:
| Q |
123 |
aaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatcttt |
178 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| |||| |||||||| |
|
|
| T |
14202065 |
aaataccatgatgtcatatttaggaagaaatttagaattcaaccactagcatcttt |
14202120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 13573961 - 13574018
Alignment:
| Q |
121 |
ccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatcttt |
178 |
Q |
| |
|
||||||| ||| || | ||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
13573961 |
ccaaatagcatgatattatattaaggaagaaaattagaattcaaccaccagcatcttt |
13574018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University