View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_454 (Length: 205)
Name: NF6876A_low_454
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_454 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 37427852 - 37427680
Alignment:
| Q |
11 |
gatggacatcagggagacagtgtaccgtcatatttacaaaagcatctcttttctaatatcttgaaggaagtgagttgttgaatcaaactaaagatattat |
110 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37427852 |
gatggacacctgggagacagtgtaccgtcatatttgcaaaagcatctcttttctaatatcttgaaggaagtgagttgttgaaacaaactaaagatattat |
37427753 |
T |
 |
| Q |
111 |
gtattggttattgcctcacatttgatttcttcggaaaagggcttttcttcctttctattttatgttgtctgtg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37427752 |
gtattggttattgcctcacatttgatttcttcggaaaagggcttttcttcctttctattttatgttgtctgtg |
37427680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 86
Target Start/End: Original strand, 1664661 - 1664706
Alignment:
| Q |
41 |
tatttacaaaagcatctcttttctaatatcttgaaggaagtgagtt |
86 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1664661 |
tatttacaaaaacatctcttttctaatatcttgaaggaagtgagtt |
1664706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University