View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_456 (Length: 203)
Name: NF6876A_low_456
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_456 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 35206363 - 35206528
Alignment:
| Q |
22 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttaccggatct |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35206363 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttacaggatct |
35206462 |
T |
 |
| Q |
122 |
gtcattagttcccgagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctatgct |
187 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35206463 |
gtcattagttccagagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctctgct |
35206528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University