View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_457 (Length: 203)
Name: NF6876A_low_457
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_457 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 177
Target Start/End: Complemental strand, 20165591 - 20165428
Alignment:
| Q |
14 |
ggacatcatttatatcccttctaacaagaatctgcttaagtgaatgacacttgaattgacttaaacacttatgtgtatagcaaggaactgaaccaaaatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20165591 |
ggacatcatttatatcccttctaacaagaatctgcttaagtgaatgacacttgaattgacttaaacacttatgtgtatagcaaggaactgaaccaaaatc |
20165492 |
T |
|
| Q |
114 |
tttatggagtaaaacaaaagcataagaaagaaaagttagacatctccacaggaattagatatta |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
20165491 |
tttatggagtaaaacaaaagcataagaaaaaaaagttagacatatccacaggaattagatatta |
20165428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University