View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6877_low_6 (Length: 343)
Name: NF6877_low_6
Description: NF6877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6877_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 4453686 - 4453850
Alignment:
| Q |
18 |
ccaactcacctacatcagattgttgcagtggtctcatacaatccaccaagaacaacaagagatgcatatgcattattattaaagacagagatgaccctga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4453686 |
ccaactcacctacatcagattgttgcagtggtctcatacaatccaccaagaacaacaagaaatgcatatgcattattattaaagacagagatgaccctga |
4453785 |
T |
|
| Q |
118 |
cctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaatacaccagata |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4453786 |
cctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaatacaccagata |
4453850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 248 - 332
Target Start/End: Original strand, 4453916 - 4454000
Alignment:
| Q |
248 |
atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttctt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4453916 |
atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttctt |
4454000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University