View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6879_high_14 (Length: 314)
Name: NF6879_high_14
Description: NF6879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6879_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 297
Target Start/End: Complemental strand, 33892999 - 33892709
Alignment:
| Q |
7 |
agcagaacctgtgctggacacttatgcaattatgcacaatatcacactccataaaaaa-gctttgctctcagatttttatttgtcagtgtcaatgcttaa |
105 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33892999 |
agcagcacctatgctggacacttatgcaactatgcacaatatcacatttcataaaaaaagctttgctctcagatttttatttgtcagtgtcaatacttaa |
33892900 |
T |
 |
| Q |
106 |
gtagcgactattaggaaattataatacaacatggtaggcatctaccg-gttctgttttcactctgaaatgattgataaattatttctgaaactgtaagtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33892899 |
gtagcgactattaggaaattataatacaacatggtaggcatctaccgagttctgttttcactctgaaatgatgcataaattatttctgaaactgtaagtg |
33892800 |
T |
 |
| Q |
205 |
ttgaatctgacgtggttgctgcatgagattgaattaccagttgtgaatctcccaatatcttgaca-ttcttgcccctattccttgtgacattgt |
297 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33892799 |
ttgaatctgacgtggt---tgcatgagattgaattaccagttgtgaatctcccaatatcttgacatttcttgcccctattccttgtgacattgt |
33892709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University