View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6879_high_18 (Length: 266)
Name: NF6879_high_18
Description: NF6879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6879_high_18 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 21650 - 21401
Alignment:
| Q |
20 |
tatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatgattctgttttcttcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21650 |
tatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatgattctgttttcttcttc |
21551 |
T |
|
| Q |
120 |
tattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgtttt------------gaggacccttttggatttgaaagaatgag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21550 |
tattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgttttgagggtttttttgaggacccttttggatttgaaagaatgag |
21451 |
T |
|
| Q |
208 |
tagttgtggaagggaaggtgttgtgagacaatatgtaagatcacaggttc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21450 |
tagttgtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttc |
21401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 257
Target Start/End: Complemental strand, 25080630 - 25080586
Alignment:
| Q |
213 |
gtggaagggaaggtgttgtgagacaatatgtaagatcacaggttc |
257 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| || |||||| |
|
|
| T |
25080630 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttc |
25080586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 257
Target Start/End: Complemental strand, 25138599 - 25138555
Alignment:
| Q |
213 |
gtggaagggaaggtgttgtgagacaatatgtaagatcacaggttc |
257 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| || |||||| |
|
|
| T |
25138599 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttc |
25138555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University