View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6879_high_23 (Length: 226)
Name: NF6879_high_23
Description: NF6879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6879_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 4369472 - 4369665
Alignment:
| Q |
17 |
caaatgcagatatataacaccaaaataaccagacaaagggtttaggttaacgtagcaaagtattagagtaaaatgtagggtttataatctaaattccgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4369472 |
caaatgcagatatataacaccaaaataaccagacaaagggtttaggttaacgtagcaaagtattagagtaaaatgtagggtttataatctaaattccgaa |
4369571 |
T |
|
| Q |
117 |
ccttatatttttctaaccaatgttgaattcagaacatggacaaagacaaaactagtgtaacaaagaaaaatcacttttccatcatttgttctctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4369572 |
ccttatatttttctaaccaatgttgaa-tcagaacatggacaaagacaagactagtgaaacaaagaaaaatcacttttccatcttttgttctctg |
4369665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University