View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6879_low_38 (Length: 217)
Name: NF6879_low_38
Description: NF6879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6879_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 31 - 199
Target Start/End: Original strand, 41004238 - 41004406
Alignment:
| Q |
31 |
tatatgctaatgatgattatgatgaaaataatgaccttgaaagaccacaatactaaatcaatgtcatcctttacaagatactataactaggtttgcttta |
130 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41004238 |
tatatactaatgatgattatgatgaaaataatgaccttgaaagaccacaatcctaaatcaatatcatcctttacaacatactataactaggtttgcttta |
41004337 |
T |
|
| Q |
131 |
tctcaaatagtgatgattaagaaccaaattgtcgaaggcctaattgatttacaaataaagctggtatat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41004338 |
tctcaaatagtgatgattaagaaccaaattgtcgaaggcctaattgatttacaaataaagctggtatat |
41004406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University