View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6879_low_40 (Length: 207)
Name: NF6879_low_40
Description: NF6879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6879_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 8 - 188
Target Start/End: Original strand, 3722544 - 3722724
Alignment:
| Q |
8 |
gagtgagatgaaggaagaaatggttaattgagtttacttgtacttggggtaaaaagttgttccttgctttactatgtaacaaaatattttacttttgcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722544 |
gagtgagatgaaggaagaaatggttaattgagtttacttgtacttggggtaaaaagttgttccttgctttactatgtaacaaaatattttacttttgcca |
3722643 |
T |
 |
| Q |
108 |
tgtacgtctatgttgtcaccccttgttttgttctatctcatagtaatttttcaaatcaaaaattaaaataatatttatatg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722644 |
tgtacgtctatgttgtcaccccttgttttgttctatctcatagtaatttttcaaatcaaaaattaaaataatatttatatg |
3722724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University