View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6880_high_18 (Length: 211)
Name: NF6880_high_18
Description: NF6880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6880_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 8254962 - 8255143
Alignment:
| Q |
18 |
caaaaaatattgtaacacttttttacaaaactcataaaattaatagttatcccgaaagcattcctattggctaaccgcatgtgttttccgcccaattcct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
8254962 |
caaaaaatactgtaacacttttttacaaaactcataaaattaatagttatcccgaaagcattcctattggctaaccacctgtgttttccgcccaattcct |
8255061 |
T |
 |
| Q |
118 |
tttgaaaaccatctcatgtatgttcacacccaactctgagtatgacatattgccttcgtgatttcttgggatggttcttctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
8255062 |
tttgaaaaccatctcatgtatgttcacacccaactctgagtatgacatattgcctttgtgatttcttgggattgtttttctc |
8255143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 97 - 193
Target Start/End: Original strand, 45102751 - 45102848
Alignment:
| Q |
97 |
tgtgttttccgcccaattccttttgaaaaccatctcatgtatgttcacacccaactctgagtatgacatatt-gccttcgtgatttcttgggatggtt |
193 |
Q |
| |
|
||||||||| ||||||||||||||||||| | ||||||||| | |||| |||||| | || |||||| || || |||||||||||||||||||||| |
|
|
| T |
45102751 |
tgtgttttctgcccaattccttttgaaaatcgcctcatgtatttccacaaccaactgtcagcatgacacgttggctttcgtgatttcttgggatggtt |
45102848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 63 - 193
Target Start/End: Complemental strand, 18962764 - 18962635
Alignment:
| Q |
63 |
gttatcccgaaagcattcctattggctaaccgcatgtgttttccgcccaattccttttgaaaaccatctcatgtatgttcacacccaactctgagtatga |
162 |
Q |
| |
|
||||||||||| ||||||||||||||| || | ||||||| ||||||||||||| || |||| ||||||||| |||||| |||||||| ||| ||| |
|
|
| T |
18962764 |
gttatcccgaatacattcctattggctacccacccgtgttttgtgcccaattccttt-gataaccgcctcatgtattttcacaaccaactctcagtgtga |
18962666 |
T |
 |
| Q |
163 |
catattgccttcgtgatttcttgggatggtt |
193 |
Q |
| |
|
||| |||| |||||||||||| |||| |||| |
|
|
| T |
18962665 |
catgttgctttcgtgatttctcgggacggtt |
18962635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University