View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6880_low_10 (Length: 324)

Name: NF6880_low_10
Description: NF6880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6880_low_10
NF6880_low_10
[»] chr6 (181 HSPs)
chr6 (12-310)||(27623968-27624264)
chr6 (18-310)||(27284627-27284917)
chr6 (18-307)||(27013378-27013665)
chr6 (18-307)||(13293211-13293501)
chr6 (18-307)||(4763409-4763696)
chr6 (18-307)||(16938291-16938577)
chr6 (18-307)||(28213100-28213386)
chr6 (18-307)||(29555204-29555490)
chr6 (18-307)||(8899965-8900253)
chr6 (18-307)||(13518459-13518744)
chr6 (18-307)||(22929148-22929434)
chr6 (18-307)||(23851593-23851879)
chr6 (18-307)||(24869356-24869642)
chr6 (18-307)||(27199831-27200118)
chr6 (18-307)||(27249116-27249403)
chr6 (18-307)||(27264380-27264664)
chr6 (18-307)||(29507062-29507348)
chr6 (18-307)||(29578660-29578947)
chr6 (18-307)||(27063129-27063414)
chr6 (18-307)||(4718401-4718685)
chr6 (18-307)||(26110676-26110962)
chr6 (18-307)||(26926416-26926702)
chr6 (18-307)||(27356377-27356660)
chr6 (18-307)||(34458772-34459056)
chr6 (18-307)||(4530931-4531220)
chr6 (18-307)||(27184575-27184860)
chr6 (18-307)||(4778526-4778812)
chr6 (18-307)||(27490779-27491065)
chr6 (18-307)||(33370697-33370981)
chr6 (18-307)||(27030669-27030954)
chr6 (18-307)||(28166137-28166426)
chr6 (18-307)||(14139660-14139944)
chr6 (18-307)||(16755467-16755752)
chr6 (18-307)||(24300021-24300307)
chr6 (18-307)||(26772894-26773177)
chr6 (18-307)||(26791462-26791748)
chr6 (18-307)||(30552282-30552566)
chr6 (19-307)||(15406796-15407083)
chr6 (19-307)||(15418583-15418870)
chr6 (24-307)||(16679786-16680065)
chr6 (18-307)||(4540025-4540324)
chr6 (18-310)||(27024780-27025077)
chr6 (25-308)||(20174192-20174474)
chr6 (25-308)||(22161517-22161799)
chr6 (165-310)||(18210101-18210246)
chr6 (165-310)||(21363070-21363215)
chr6 (165-310)||(23967052-23967197)
chr6 (167-310)||(18122088-18122231)
chr6 (165-310)||(25709573-25709720)
chr6 (165-310)||(27547521-27547668)
chr6 (167-243)||(25710269-25710345)
chr6 (167-243)||(27548259-27548335)
chr6 (160-246)||(16584636-16584723)
chr6 (160-246)||(16610657-16610744)
chr6 (160-243)||(27515738-27515821)
chr6 (160-246)||(18752933-18753019)
chr6 (160-244)||(16639612-16639697)
chr6 (164-208)||(27623314-27623358)
chr6 (160-246)||(174323-174410)
chr6 (160-246)||(27053474-27053561)
chr6 (160-246)||(15648234-15648320)
chr6 (165-243)||(27200632-27200710)
chr6 (165-243)||(27248523-27248601)
chr6 (165-243)||(27491578-27491656)
chr6 (165-206)||(4539366-4539407)
chr6 (165-206)||(8899307-8899348)
chr6 (165-246)||(8899373-8899454)
chr6 (165-264)||(9133783-9133884)
chr6 (165-206)||(14139008-14139049)
chr6 (165-206)||(15406141-15406182)
chr6 (165-206)||(15417928-15417969)
chr6 (165-206)||(16680688-16680729)
chr6 (165-206)||(16937633-16937674)
chr6 (165-206)||(22928488-22928529)
chr6 (165-206)||(24299368-24299409)
chr6 (165-206)||(26110017-26110058)
chr6 (165-206)||(26666266-26666307)
chr6 (165-206)||(26772237-26772278)
chr6 (165-206)||(26927301-26927342)
chr6 (165-206)||(27014275-27014316)
chr6 (165-206)||(27031569-27031610)
chr6 (165-206)||(27064030-27064071)
chr6 (165-246)||(27070573-27070654)
chr6 (165-206)||(27209449-27209490)
chr6 (165-206)||(27239738-27239779)
chr6 (165-206)||(27491681-27491722)
chr6 (165-206)||(28167044-28167085)
chr6 (165-206)||(28214004-28214045)
chr6 (165-206)||(29507967-29508008)
chr6 (165-206)||(29579563-29579604)
chr6 (165-206)||(30551608-30551649)
chr6 (165-206)||(33370039-33370080)
chr6 (167-246)||(22775499-22775578)
chr6 (160-246)||(28308741-28308828)
chr6 (165-243)||(4779327-4779405)
chr6 (165-243)||(13517868-13517946)
chr6 (165-243)||(27355785-27355863)
chr6 (165-243)||(28166941-28167019)
chr6 (165-243)||(29507864-29507942)
chr6 (165-203)||(34458116-34458154)
chr6 (165-206)||(4531837-4531878)
chr6 (165-206)||(4764312-4764353)
chr6 (165-206)||(4779430-4779471)
chr6 (165-206)||(13292557-13292598)
chr6 (165-206)||(13517802-13517843)
chr6 (165-206)||(16756370-16756411)
chr6 (169-206)||(24870254-24870291)
chr6 (165-206)||(26792365-26792406)
chr6 (165-206)||(27025691-27025732)
chr6 (165-206)||(27200736-27200777)
chr6 (165-206)||(27248456-27248497)
chr6 (165-206)||(27355719-27355760)
chr6 (165-246)||(30551674-30551755)
chr6 (160-203)||(18209466-18209509)
chr6 (167-246)||(19717332-19717411)
chr6 (160-207)||(20052568-20052615)
chr6 (160-203)||(21362458-21362501)
chr6 (160-243)||(22774807-22774890)
chr6 (160-203)||(23966440-23966483)
chr6 (165-208)||(27283970-27284013)
chr6 (165-243)||(4531734-4531812)
chr6 (165-243)||(4539432-4539510)
chr6 (165-243)||(4764209-4764287)
chr6 (165-243)||(13292623-13292701)
chr6 (165-243)||(14139074-14139152)
chr6 (165-243)||(16680585-16680663)
chr6 (165-243)||(16756267-16756345)
chr6 (165-243)||(24299434-24299512)
chr6 (165-243)||(24870151-24870229)
chr6 (165-243)||(26110083-26110161)
chr6 (165-243)||(27014172-27014250)
chr6 (165-243)||(27025587-27025665)
chr6 (165-243)||(27209346-27209424)
chr6 (165-243)||(27239804-27239882)
chr6 (165-243)||(28213901-28213979)
chr6 (165-243)||(33370105-33370183)
chr6 (165-243)||(34458182-34458260)
chr6 (159-208)||(617722-617771)
chr6 (167-208)||(16584828-16584869)
chr6 (167-208)||(16610511-16610552)
chr6 (167-208)||(18752872-18752913)
chr6 (159-208)||(20042454-20042503)
chr6 (165-206)||(20175111-20175152)
chr6 (165-206)||(22160839-22160880)
chr6 (167-208)||(27053410-27053451)
chr6 (167-208)||(27069791-27069832)
chr6 (159-208)||(27515909-27515958)
chr6 (167-208)||(28308849-28308890)
chr6 (169-206)||(29556107-29556144)
chr6 (167-246)||(5991773-5991853)
chr6 (165-229)||(20053280-20053344)
chr6 (167-246)||(25501206-25501286)
chr6 (166-246)||(26666333-26666413)
chr6 (166-246)||(26772304-26772384)
chr6 (160-208)||(27515841-27515889)
chr6 (160-207)||(617790-617837)
chr6 (160-203)||(18122852-18122895)
chr6 (160-207)||(18439252-18439299)
chr6 (160-207)||(20042520-20042567)
chr6 (167-206)||(21362394-21362433)
chr6 (167-206)||(23966376-23966415)
chr6 (160-207)||(24145320-24145367)
chr6 (167-230)||(27515053-27515116)
chr6 (158-208)||(174433-174483)
chr6 (165-243)||(15406207-15406285)
chr6 (165-243)||(15417994-15418072)
chr6 (165-243)||(26792262-26792340)
chr6 (165-243)||(26927198-26927276)
chr6 (165-243)||(27031466-27031544)
chr6 (160-202)||(27052445-27052487)
chr6 (165-243)||(27063927-27064005)
chr6 (165-243)||(29579460-29579538)
chr6 (167-208)||(16584746-16584787)
chr6 (167-208)||(16610593-16610634)
chr6 (160-244)||(16640583-16640668)
chr6 (165-246)||(16937699-16937780)
chr6 (167-208)||(24145261-24145302)
chr6 (53-110)||(27070573-27070630)
chr6 (165-242)||(29556005-29556082)
chr6 (166-246)||(23878677-23878756)
chr6 (52-84)||(27283969-27284001)
[»] chr7 (167 HSPs)
chr7 (12-307)||(2104360-2104655)
chr7 (18-307)||(5141540-5141832)
chr7 (21-307)||(26664121-26664406)
chr7 (21-307)||(26679313-26679598)
chr7 (18-307)||(24586740-24587026)
chr7 (18-307)||(2778900-2779184)
chr7 (19-310)||(16046960-16047247)
chr7 (20-307)||(26269296-26269578)
chr7 (18-307)||(4205035-4205321)
chr7 (18-307)||(5164029-5164316)
chr7 (18-307)||(31558598-31558882)
chr7 (18-307)||(45392866-45393150)
chr7 (18-310)||(16512639-16512925)
chr7 (18-307)||(26532075-26532365)
chr7 (18-310)||(16444208-16444501)
chr7 (21-307)||(26314056-26314340)
chr7 (18-307)||(11446533-11446820)
chr7 (18-307)||(16732735-16733018)
chr7 (18-307)||(16745726-16746009)
chr7 (18-307)||(26440903-26441185)
chr7 (20-307)||(39207346-39207631)
chr7 (18-307)||(4139452-4139738)
chr7 (18-307)||(5153730-5154016)
chr7 (18-307)||(26518438-26518725)
chr7 (18-307)||(31084828-31085114)
chr7 (18-307)||(31129553-31129837)
chr7 (18-307)||(26509902-26510188)
chr7 (18-307)||(11418984-11419271)
chr7 (18-307)||(45736953-45737235)
chr7 (21-307)||(2160220-2160500)
chr7 (22-307)||(3450952-3451246)
chr7 (114-310)||(10847263-10847453)
chr7 (18-197)||(10911125-10911299)
chr7 (213-307)||(10911267-10911361)
chr7 (165-310)||(15195702-15195847)
chr7 (165-310)||(2559154-2559299)
chr7 (165-310)||(29092135-29092280)
chr7 (165-310)||(16125215-16125360)
chr7 (165-310)||(16240035-16240180)
chr7 (165-310)||(1890947-1891094)
chr7 (165-263)||(9471981-9472080)
chr7 (167-243)||(1890265-1890341)
chr7 (160-246)||(27971365-27971452)
chr7 (160-246)||(16267904-16267990)
chr7 (160-246)||(5204232-5204319)
chr7 (160-246)||(13836699-13836786)
chr7 (165-251)||(16390806-16390893)
chr7 (165-243)||(3451765-3451843)
chr7 (165-243)||(11418392-11418470)
chr7 (165-293)||(30367318-30367448)
chr7 (165-243)||(39206753-39206831)
chr7 (165-206)||(2161121-2161162)
chr7 (165-206)||(2779795-2779836)
chr7 (165-206)||(5154632-5154673)
chr7 (165-206)||(5164934-5164975)
chr7 (165-206)||(10848134-10848175)
chr7 (165-206)||(10910473-10910514)
chr7 (165-206)||(11418326-11418367)
chr7 (165-206)||(16511987-16512028)
chr7 (165-206)||(24586082-24586123)
chr7 (165-246)||(24586148-24586229)
chr7 (165-206)||(26268632-26268673)
chr7 (165-206)||(26441800-26441841)
chr7 (165-206)||(26596219-26596260)
chr7 (165-206)||(26663459-26663500)
chr7 (165-206)||(26678651-26678692)
chr7 (165-206)||(31557941-31557982)
chr7 (165-206)||(39206687-39206728)
chr7 (166-206)||(4138793-4138833)
chr7 (222-310)||(13482633-13482724)
chr7 (160-246)||(564273-564360)
chr7 (160-246)||(27439567-27439654)
chr7 (43-81)||(10847452-10847490)
chr7 (165-243)||(16745133-16745211)
chr7 (165-203)||(22148441-22148479)
chr7 (165-203)||(22152668-22152706)
chr7 (165-203)||(22208583-22208621)
chr7 (165-243)||(26519237-26519315)
chr7 (165-243)||(31130345-31130423)
chr7 (165-243)||(31558007-31558085)
chr7 (165-243)||(45737749-45737827)
chr7 (165-206)||(5140881-5140922)
chr7 (165-206)||(11447437-11447478)
chr7 (167-208)||(12589347-12589388)
chr7 (165-202)||(16047866-16047903)
chr7 (165-246)||(16268608-16268689)
chr7 (165-206)||(16443550-16443591)
chr7 (165-206)||(26313396-26313437)
chr7 (165-206)||(26519340-26519381)
chr7 (165-246)||(31084235-31084316)
chr7 (165-206)||(31130448-31130489)
chr7 (165-206)||(45393768-45393809)
chr7 (165-206)||(45737852-45737893)
chr7 (179-262)||(795912-795996)
chr7 (165-205)||(4205939-4205979)
chr7 (179-262)||(16284768-16284852)
chr7 (179-246)||(1956304-1956371)
chr7 (160-243)||(9472649-9472732)
chr7 (180-243)||(11447334-11447397)
chr7 (160-203)||(16124570-16124613)
chr7 (165-208)||(26509242-26509285)
chr7 (160-203)||(29092889-29092932)
chr7 (167-246)||(34135471-34135550)
chr7 (160-246)||(38409036-38409123)
chr7 (164-246)||(3426982-3427064)
chr7 (165-243)||(4205835-4205913)
chr7 (165-243)||(5140947-5141025)
chr7 (165-243)||(5154529-5154607)
chr7 (165-243)||(10848031-10848109)
chr7 (165-243)||(10910539-10910617)
chr7 (158-208)||(13836811-13836861)
chr7 (165-243)||(26268698-26268776)
chr7 (165-243)||(26313462-26313540)
chr7 (165-243)||(26663525-26663603)
chr7 (165-243)||(26678717-26678795)
chr7 (165-243)||(45393665-45393743)
chr7 (167-208)||(564209-564250)
chr7 (53-110)||(795898-795955)
chr7 (167-208)||(4942935-4942976)
chr7 (167-208)||(5204168-5204209)
chr7 (159-208)||(8816090-8816139)
chr7 (159-208)||(9472747-9472796)
chr7 (53-110)||(16284754-16284811)
chr7 (159-208)||(16390073-16390122)
chr7 (167-208)||(16482197-16482238)
chr7 (159-208)||(23881145-23881194)
chr7 (167-208)||(27971301-27971342)
chr7 (167-208)||(29027761-29027802)
chr7 (165-206)||(31084169-31084210)
chr7 (167-208)||(38409146-38409187)
chr7 (159-208)||(42632819-42632868)
chr7 (159-207)||(30366618-30366666)
chr7 (167-206)||(563195-563234)
chr7 (160-207)||(844181-844228)
chr7 (160-207)||(851357-851404)
chr7 (160-207)||(1209361-1209408)
chr7 (160-207)||(3426271-3426318)
chr7 (160-246)||(4942998-4943085)
chr7 (160-207)||(8816028-8816075)
chr7 (167-206)||(16240846-16240885)
chr7 (160-207)||(16390140-16390187)
chr7 (180-243)||(16443631-16443694)
chr7 (184-243)||(22152561-22152620)
chr7 (184-243)||(22208476-22208535)
chr7 (160-207)||(42632885-42632932)
chr7 (165-243)||(2161018-2161096)
chr7 (160-206)||(2559903-2559949)
chr7 (165-243)||(2779692-2779770)
chr7 (165-243)||(4138858-4138936)
chr7 (165-243)||(5164830-5164908)
chr7 (165-219)||(12588557-12588611)
chr7 (165-243)||(16047759-16047837)
chr7 (53-103)||(16240130-16240180)
chr7 (160-202)||(16240772-16240814)
chr7 (167-205)||(16267844-16267882)
chr7 (165-243)||(16512053-16512131)
chr7 (169-206)||(16745070-16745108)
chr7 (165-243)||(26596116-26596194)
chr7 (53-103)||(29092230-29092280)
chr7 (166-203)||(563260-563297)
chr7 (55-100)||(565046-565091)
chr7 (53-110)||(9472023-9472080)
chr7 (53-110)||(16390806-16390863)
chr7 (165-206)||(27970372-27970413)
chr7 (160-246)||(29027650-29027738)
chr7 (167-207)||(23881217-23881257)
chr7 (52-84)||(26509241-26509273)
[»] chr5 (219 HSPs)
chr5 (20-307)||(43083911-43084198)
chr5 (18-307)||(13181008-13181297)
chr5 (21-307)||(30157687-30157972)
chr5 (18-307)||(9544927-9545213)
chr5 (18-307)||(13436900-13437187)
chr5 (18-310)||(23897528-23897817)
chr5 (18-307)||(31437120-31437406)
chr5 (18-307)||(37746546-37746833)
chr5 (18-307)||(40467772-40468054)
chr5 (18-307)||(6879961-6880245)
chr5 (18-307)||(13319046-13319334)
chr5 (18-307)||(23631625-23631911)
chr5 (18-307)||(24729625-24729912)
chr5 (18-307)||(34622174-34622460)
chr5 (18-307)||(15652977-15653261)
chr5 (18-307)||(18369751-18370038)
chr5 (18-307)||(32590494-32590778)
chr5 (18-307)||(33880784-33881069)
chr5 (18-307)||(37352863-37353147)
chr5 (18-307)||(18494986-18495276)
chr5 (18-306)||(24975504-24975791)
chr5 (18-310)||(25270086-25270376)
chr5 (18-307)||(33783141-33783429)
chr5 (18-307)||(3795197-3795480)
chr5 (18-307)||(15753070-15753356)
chr5 (18-307)||(30035084-30035369)
chr5 (18-307)||(31820627-31820911)
chr5 (18-307)||(37665705-37665990)
chr5 (18-298)||(24607910-24608188)
chr5 (18-310)||(25205931-25206220)
chr5 (20-307)||(11329293-11329577)
chr5 (18-310)||(22894064-22894359)
chr5 (21-307)||(26486050-26486335)
chr5 (18-307)||(2516718-2517007)
chr5 (18-307)||(8659690-8659979)
chr5 (21-307)||(9323132-9323416)
chr5 (21-307)||(12137831-12138115)
chr5 (21-307)||(30174125-30174404)
chr5 (18-307)||(11555011-11555296)
chr5 (18-307)||(28654899-28655184)
chr5 (18-307)||(30940291-30940578)
chr5 (18-307)||(33522036-33522321)
chr5 (18-307)||(37760639-37760924)
chr5 (22-307)||(28954003-28954289)
chr5 (18-305)||(33298186-33298475)
chr5 (18-307)||(18122635-18122920)
chr5 (18-307)||(22993335-22993621)
chr5 (18-307)||(41680361-41680646)
chr5 (18-307)||(5643444-5643744)
chr5 (181-310)||(29885575-29885704)
chr5 (165-310)||(3481589-3481734)
chr5 (165-310)||(20375015-20375162)
chr5 (165-263)||(5437611-5437710)
chr5 (165-263)||(11941808-11941907)
chr5 (160-245)||(21862452-21862538)
chr5 (160-246)||(21990740-21990827)
chr5 (160-246)||(27228714-27228801)
chr5 (165-293)||(15782109-15782239)
chr5 (165-293)||(31522953-31523082)
chr5 (167-246)||(12175675-12175755)
chr5 (165-311)||(17959725-17959873)
chr5 (160-246)||(11808515-11808602)
chr5 (160-246)||(26084454-26084541)
chr5 (160-246)||(28849200-28849287)
chr5 (160-243)||(29899076-29899159)
chr5 (165-263)||(36373346-36373445)
chr5 (165-263)||(36998000-36998099)
chr5 (165-206)||(2517625-2517666)
chr5 (165-206)||(6880863-6880904)
chr5 (165-206)||(9324035-9324076)
chr5 (165-206)||(9544268-9544309)
chr5 (165-206)||(11555912-11555953)
chr5 (165-206)||(12138734-12138775)
chr5 (165-206)||(13180354-13180395)
chr5 (165-206)||(13318389-13318430)
chr5 (165-206)||(15652322-15652363)
chr5 (165-206)||(18369093-18369134)
chr5 (165-206)||(18494329-18494370)
chr5 (165-206)||(22992685-22992726)
chr5 (165-206)||(23632530-23632571)
chr5 (165-206)||(23726794-23726835)
chr5 (165-206)||(24730529-24730570)
chr5 (165-206)||(24976402-24976443)
chr5 (165-206)||(25206843-25206884)
chr5 (165-206)||(25270999-25271040)
chr5 (165-206)||(26486944-26486985)
chr5 (165-206)||(28953339-28953380)
chr5 (165-206)||(30175025-30175066)
chr5 (165-206)||(30941190-30941231)
chr5 (165-206)||(31438016-31438057)
chr5 (165-206)||(33299096-33299137)
chr5 (165-246)||(33522836-33522917)
chr5 (165-206)||(37352205-37352246)
chr5 (165-206)||(40467112-40467153)
chr5 (165-206)||(41681264-41681305)
chr5 (165-206)||(43084816-43084857)
chr5 (160-246)||(20382387-20382474)
chr5 (167-246)||(21692651-21692730)
chr5 (167-206)||(23898428-23898467)
chr5 (160-246)||(33839997-33840084)
chr5 (165-243)||(3795995-3796073)
chr5 (165-203)||(3796101-3796139)
chr5 (165-243)||(6880760-6880838)
chr5 (165-243)||(15752485-15752563)
chr5 (165-243)||(18369159-18369237)
chr5 (165-243)||(23632427-23632505)
chr5 (165-243)||(28655699-28655777)
chr5 (165-243)||(30035882-30035960)
chr5 (165-243)||(30158490-30158568)
chr5 (165-243)||(32589903-32589981)
chr5 (165-243)||(33881582-33881660)
chr5 (165-243)||(41681161-41681239)
chr5 (165-206)||(8659033-8659074)
chr5 (165-206)||(11330198-11330239)
chr5 (165-206)||(13436231-13436272)
chr5 (165-206)||(15752419-15752460)
chr5 (167-243)||(20374383-20374460)
chr5 (165-206)||(28655802-28655843)
chr5 (165-206)||(30035985-30036026)
chr5 (165-206)||(30158593-30158634)
chr5 (165-206)||(31819974-31820015)
chr5 (165-206)||(33522942-33522983)
chr5 (165-206)||(33881685-33881726)
chr5 (165-206)||(34623079-34623120)
chr5 (165-246)||(37352271-37352352)
chr5 (165-206)||(37665046-37665087)
chr5 (165-206)||(37761539-37761580)
chr5 (179-262)||(34471297-34471381)
chr5 (160-246)||(24959875-24959962)
chr5 (167-246)||(37582505-37582584)
chr5 (165-243)||(5644254-5644332)
chr5 (165-243)||(8659099-8659177)
chr5 (165-243)||(9323932-9324010)
chr5 (165-243)||(9544334-9544412)
chr5 (165-243)||(11330095-11330173)
chr5 (165-243)||(12138631-12138709)
chr5 (165-243)||(13180420-13180498)
chr5 (165-243)||(13318455-13318533)
chr5 (165-243)||(15652387-15652465)
chr5 (165-243)||(18122043-18122121)
chr5 (165-243)||(18494395-18494473)
chr5 (165-243)||(22894872-22894950)
chr5 (165-203)||(22894978-22895016)
chr5 (165-235)||(22953997-22954067)
chr5 (165-243)||(23898325-23898403)
chr5 (165-243)||(24608697-24608775)
chr5 (165-243)||(24730426-24730504)
chr5 (165-243)||(25206740-25206818)
chr5 (165-243)||(25270896-25270974)
chr5 (165-243)||(26486841-26486919)
chr5 (165-243)||(30174922-30175000)
chr5 (165-243)||(30941086-30941164)
chr5 (165-243)||(33783938-33784016)
chr5 (165-243)||(37665113-37665191)
chr5 (165-243)||(37745949-37746027)
chr5 (165-243)||(43084713-43084791)
chr5 (222-310)||(349655-349746)
chr5 (159-208)||(1803789-1803838)
chr5 (165-206)||(5644357-5644398)
chr5 (159-208)||(7792487-7792536)
chr5 (167-208)||(11808451-11808492)
chr5 (159-208)||(12389769-12389818)
chr5 (159-208)||(15781324-15781373)
chr5 (167-208)||(20382509-20382550)
chr5 (159-208)||(21693467-21693516)
chr5 (167-208)||(21862384-21862425)
chr5 (165-206)||(24608800-24608841)
chr5 (167-208)||(26084390-26084431)
chr5 (167-208)||(27228650-27228691)
chr5 (167-208)||(28849307-28849348)
chr5 (165-246)||(28953405-28953486)
chr5 (159-208)||(31523807-31523856)
chr5 (165-206)||(32589838-32589878)
chr5 (165-206)||(33784041-33784082)
chr5 (167-208)||(33839934-33839975)
chr5 (159-208)||(36372617-36372666)
chr5 (159-208)||(36997280-36997329)
chr5 (165-206)||(37745883-37745924)
chr5 (167-243)||(12389840-12389916)
chr5 (54-110)||(34471338-34471394)
chr5 (160-207)||(1803725-1803772)
chr5 (160-203)||(3480908-3480951)
chr5 (160-207)||(7256580-7256627)
chr5 (160-207)||(7792423-7792470)
chr5 (160-207)||(11941142-11941189)
chr5 (160-207)||(15781388-15781435)
chr5 (55-110)||(24960667-24960722)
chr5 (55-110)||(28848456-28848511)
chr5 (160-207)||(31523740-31523787)
chr5 (160-207)||(36372683-36372730)
chr5 (167-246)||(36451941-36452020)
chr5 (160-207)||(36997346-36997393)
chr5 (165-243)||(2517522-2517600)
chr5 (165-243)||(11555809-11555887)
chr5 (165-243)||(13436297-13436375)
chr5 (165-243)||(22992751-22992829)
chr5 (53-103)||(24064552-24064602)
chr5 (165-243)||(24976299-24976377)
chr5 (160-202)||(27227697-27227739)
chr5 (165-243)||(31437913-31437991)
chr5 (165-243)||(31820037-31820115)
chr5 (165-243)||(33298993-33299071)
chr5 (53-110)||(5437611-5437668)
chr5 (159-208)||(7256515-7256564)
chr5 (167-228)||(7257278-7257339)
chr5 (166-203)||(11807500-11807537)
chr5 (167-208)||(11941085-11941126)
chr5 (53-110)||(11941808-11941865)
chr5 (166-203)||(12174688-12174725)
chr5 (55-100)||(12176455-12176500)
chr5 (55-100)||(21863308-21863353)
chr5 (160-197)||(23641605-23641642)
chr5 (167-208)||(23641665-23641706)
chr5 (167-208)||(23831175-23831216)
chr5 (160-197)||(23831239-23831276)
chr5 (179-262)||(24064566-24064651)
chr5 (166-203)||(26083414-26083451)
chr5 (55-100)||(26085218-26085263)
chr5 (53-110)||(31523025-31523082)
[»] chr1 (58 HSPs)
chr1 (18-307)||(3646794-3647083)
chr1 (18-310)||(20334735-20335026)
chr1 (18-310)||(16202353-16202644)
chr1 (18-307)||(10968316-10968602)
chr1 (18-307)||(51643869-51644157)
chr1 (20-307)||(41787632-41787917)
chr1 (18-307)||(28590732-28591020)
chr1 (28-310)||(20466428-20466706)
chr1 (18-307)||(10950728-10951028)
chr1 (18-307)||(28155388-28155665)
chr1 (18-307)||(21892067-21892354)
chr1 (165-260)||(22491718-22491814)
chr1 (165-310)||(13456400-13456547)
chr1 (160-246)||(13469057-13469144)
chr1 (165-293)||(5626485-5626615)
chr1 (167-243)||(13457105-13457181)
chr1 (160-246)||(31557456-31557543)
chr1 (165-206)||(3647701-3647742)
chr1 (165-206)||(10951646-10951687)
chr1 (165-206)||(16201696-16201737)
chr1 (165-206)||(20334076-20334117)
chr1 (165-206)||(20467340-20467381)
chr1 (165-206)||(28591635-28591676)
chr1 (165-206)||(41786970-41787011)
chr1 (165-206)||(51644776-51644817)
chr1 (160-230)||(2337741-2337811)
chr1 (165-243)||(28156179-28156257)
chr1 (165-243)||(41787036-41787114)
chr1 (165-246)||(10969114-10969195)
chr1 (165-206)||(28156282-28156323)
chr1 (160-246)||(31545362-31545449)
chr1 (167-246)||(35073259-35073338)
chr1 (165-243)||(3647598-3647676)
chr1 (165-243)||(10951543-10951621)
chr1 (165-203)||(21891419-21891457)
chr1 (165-243)||(28591532-28591610)
chr1 (165-243)||(51644673-51644751)
chr1 (165-246)||(2338463-2338544)
chr1 (167-243)||(2389947-2390026)
chr1 (159-208)||(5625727-5625776)
chr1 (53-110)||(6200107-6200164)
chr1 (165-206)||(10969220-10969261)
chr1 (167-208)||(31557566-31557607)
chr1 (160-207)||(5625793-5625840)
chr1 (160-207)||(6199407-6199454)
chr1 (179-262)||(9297219-9297302)
chr1 (55-110)||(31544599-31544654)
chr1 (165-207)||(14815457-14815499)
chr1 (165-243)||(20334142-20334220)
chr1 (165-243)||(20467237-20467315)
chr1 (165-246)||(1959530-1959611)
chr1 (167-208)||(2337679-2337720)
chr1 (159-208)||(14815384-14815433)
chr1 (165-230)||(19372899-19372964)
chr1 (167-208)||(31545470-31545511)
chr1 (167-208)||(35074070-35074111)
chr1 (52-84)||(10969230-10969262)
chr1 (167-207)||(21454647-21454687)
[»] chr3 (252 HSPs)
chr3 (12-310)||(16618848-16619143)
chr3 (18-307)||(5716684-5716966)
chr3 (18-307)||(5764492-5764774)
chr3 (21-307)||(47029063-47029348)
chr3 (18-307)||(5727594-5727876)
chr3 (22-310)||(19700096-19700381)
chr3 (19-310)||(16421792-16422080)
chr3 (18-307)||(18248351-18248636)
chr3 (18-310)||(15887069-15887358)
chr3 (20-307)||(5019324-5019609)
chr3 (18-307)||(4629395-4629683)
chr3 (18-307)||(5472598-5472886)
chr3 (18-307)||(5590723-5591007)
chr3 (18-307)||(8283831-8284119)
chr3 (18-307)||(17971226-17971511)
chr3 (18-307)||(18230806-18231091)
chr3 (18-307)||(29143119-29143406)
chr3 (18-307)||(48471537-48471825)
chr3 (18-307)||(22865208-22865498)
chr3 (18-307)||(22880267-22880557)
chr3 (18-307)||(29659330-29659620)
chr3 (20-307)||(8002170-8002456)
chr3 (20-307)||(51787633-51787918)
chr3 (18-310)||(4689262-4689549)
chr3 (18-307)||(5603677-5603964)
chr3 (18-307)||(20071650-20071933)
chr3 (18-307)||(20571208-20571493)
chr3 (18-307)||(22381941-22382228)
chr3 (18-307)||(28110318-28110604)
chr3 (18-307)||(31958819-31959105)
chr3 (20-307)||(10648683-10648967)
chr3 (20-307)||(21680313-21680597)
chr3 (21-307)||(5657747-5658030)
chr3 (18-307)||(6207514-6207798)
chr3 (18-307)||(8217244-8217530)
chr3 (18-307)||(17979315-17979599)
chr3 (22-307)||(18056872-18057154)
chr3 (18-307)||(18286716-18287003)
chr3 (18-307)||(18302017-18302304)
chr3 (18-307)||(28344786-28345069)
chr3 (18-307)||(31030600-31030886)
chr3 (18-307)||(35886376-35886662)
chr3 (18-307)||(32444761-32445052)
chr3 (18-307)||(10401754-10402047)
chr3 (18-307)||(4341039-4341326)
chr3 (18-307)||(11104724-11105009)
chr3 (18-307)||(18336240-18336526)
chr3 (18-307)||(4422525-4422817)
chr3 (20-307)||(4790998-4791285)
chr3 (20-307)||(6537107-6537391)
chr3 (18-307)||(32296238-32296527)
chr3 (18-307)||(4727240-4727531)
chr3 (18-307)||(28026891-28027189)
chr3 (21-307)||(15735460-15735744)
chr3 (18-307)||(24333773-24334071)
chr3 (158-307)||(7078816-7078965)
chr3 (18-147)||(7078994-7079122)
chr3 (165-310)||(11922890-11923035)
chr3 (165-310)||(22962036-22962181)
chr3 (165-310)||(6573937-6574084)
chr3 (165-310)||(7086577-7086721)
chr3 (165-310)||(27561342-27561489)
chr3 (160-246)||(17931137-17931223)
chr3 (165-263)||(37258241-37258340)
chr3 (165-293)||(46382934-46383064)
chr3 (160-246)||(25268912-25268999)
chr3 (165-293)||(15707073-15707203)
chr3 (165-246)||(8609867-8609948)
chr3 (165-308)||(18904732-18904877)
chr3 (167-243)||(4453051-4453127)
chr3 (165-310)||(4452358-4452505)
chr3 (167-310)||(6960964-6961110)
chr3 (160-246)||(10717369-10717456)
chr3 (160-243)||(30091454-30091537)
chr3 (165-243)||(5603083-5603161)
chr3 (165-293)||(5948332-5948462)
chr3 (165-243)||(8218048-8218126)
chr3 (165-243)||(10402560-10402638)
chr3 (165-243)||(22864618-22864696)
chr3 (165-243)||(22879677-22879755)
chr3 (165-243)||(28027701-28027779)
chr3 (165-243)||(28345582-28345660)
chr3 (165-243)||(31958225-31958303)
chr3 (165-246)||(71805-71886)
chr3 (165-206)||(4340380-4340421)
chr3 (165-206)||(4690160-4690201)
chr3 (165-206)||(5473502-5473543)
chr3 (165-206)||(5590061-5590102)
chr3 (165-206)||(5603017-5603058)
chr3 (165-206)||(5658646-5658687)
chr3 (165-206)||(5717584-5717625)
chr3 (165-206)||(5728494-5728535)
chr3 (165-206)||(5763833-5763874)
chr3 (165-206)||(6208409-6208450)
chr3 (165-206)||(7079742-7079783)
chr3 (165-206)||(8218151-8218192)
chr3 (165-206)||(10402663-10402704)
chr3 (165-206)||(11104066-11104107)
chr3 (167-293)||(15581640-15581768)
chr3 (165-206)||(15734817-15734858)
chr3 (165-206)||(15886445-15886486)
chr3 (165-206)||(16422699-16422740)
chr3 (165-206)||(16618207-16618248)
chr3 (165-206)||(17970570-17970611)
chr3 (165-206)||(17978652-17978693)
chr3 (165-246)||(18231602-18231683)
chr3 (165-206)||(18231708-18231749)
chr3 (165-206)||(18249252-18249293)
chr3 (165-246)||(18286125-18286206)
chr3 (165-246)||(18301426-18301507)
chr3 (165-206)||(18337138-18337179)
chr3 (165-206)||(20570552-20570593)
chr3 (165-206)||(21681215-21681256)
chr3 (165-206)||(22864552-22864593)
chr3 (165-206)||(22879611-22879652)
chr3 (165-206)||(24334690-24334731)
chr3 (165-206)||(28027804-28027845)
chr3 (165-206)||(29142458-29142499)
chr3 (165-206)||(29658672-29658713)
chr3 (165-206)||(31958159-31958200)
chr3 (165-206)||(35887275-35887316)
chr3 (165-206)||(47029969-47030010)
chr3 (165-206)||(48472446-48472487)
chr3 (158-246)||(3240297-3240385)
chr3 (167-246)||(15532445-15532524)
chr3 (165-293)||(15921089-15921219)
chr3 (160-243)||(23283719-23283802)
chr3 (164-246)||(3681389-3681471)
chr3 (165-243)||(4340446-4340524)
chr3 (165-243)||(4630196-4630274)
chr3 (165-243)||(5020124-5020202)
chr3 (165-243)||(5473399-5473477)
chr3 (165-243)||(6208309-6208387)
chr3 (165-243)||(8283228-8283306)
chr3 (165-243)||(10649483-10649561)
chr3 (165-243)||(18249149-18249227)
chr3 (165-243)||(21681112-21681190)
chr3 (165-243)||(22381351-22381429)
chr3 (165-243)||(24334587-24334665)
chr3 (165-243)||(29142524-29142602)
chr3 (165-243)||(29658738-29658816)
chr3 (164-246)||(30017945-30018027)
chr3 (165-243)||(48472343-48472421)
chr3 (165-243)||(51788433-51788511)
chr3 (165-246)||(3408681-3408762)
chr3 (165-206)||(4423433-4423474)
chr3 (165-206)||(4630299-4630340)
chr3 (165-206)||(4728140-4728181)
chr3 (165-206)||(4790337-4790378)
chr3 (165-206)||(5020227-5020268)
chr3 (165-206)||(8283162-8283203)
chr3 (165-206)||(10649586-10649627)
chr3 (167-247)||(15707801-15707884)
chr3 (225-310)||(17437928-17438012)
chr3 (165-206)||(18286059-18286100)
chr3 (165-206)||(18301360-18301401)
chr3 (165-206)||(20072550-20072591)
chr3 (165-206)||(22381285-22381326)
chr3 (165-206)||(28109655-28109696)
chr3 (165-206)||(28345685-28345726)
chr3 (165-206)||(31029948-31029989)
chr3 (165-202)||(32297149-32297186)
chr3 (165-206)||(32445664-32445705)
chr3 (165-206)||(51788536-51788577)
chr3 (160-243)||(72530-72614)
chr3 (165-205)||(6536447-6536487)
chr3 (167-207)||(15580893-15580933)
chr3 (179-262)||(20445746-20445830)
chr3 (167-246)||(15624539-15624618)
chr3 (160-246)||(41003686-41003773)
chr3 (160-246)||(41012467-41012554)
chr3 (165-243)||(4423330-4423408)
chr3 (165-243)||(4728040-4728118)
chr3 (165-243)||(4790403-4790481)
chr3 (165-243)||(5590127-5590205)
chr3 (165-243)||(5717481-5717559)
chr3 (165-243)||(5728391-5728469)
chr3 (165-243)||(5763899-5763977)
chr3 (165-243)||(6536513-6536591)
chr3 (165-243)||(7079639-7079717)
chr3 (165-243)||(11104132-11104210)
chr3 (165-243)||(15886511-15886589)
chr3 (165-243)||(17970636-17970714)
chr3 (165-243)||(17978718-17978796)
chr3 (165-203)||(18057781-18057819)
chr3 (165-243)||(18337034-18337112)
chr3 (165-243)||(20072447-20072525)
chr3 (165-235)||(23284455-23284525)
chr3 (165-243)||(31030014-31030092)
chr3 (165-243)||(32445561-32445639)
chr3 (165-243)||(47029866-47029944)
chr3 (159-208)||(5947566-5947615)
chr3 (159-208)||(6200087-6200136)
chr3 (160-246)||(8200259-8200347)
chr3 (159-208)||(8810171-8810220)
chr3 (167-208)||(10717305-10717346)
chr3 (165-230)||(12475407-12475472)
chr3 (167-208)||(14661917-14661958)
chr3 (53-110)||(20445787-20445844)
chr3 (167-208)||(25269022-25269063)
chr3 (167-243)||(27560673-27560752)
chr3 (165-230)||(30092174-30092239)
chr3 (165-242)||(32297043-32297120)
chr3 (159-208)||(46383790-46383839)
chr3 (159-208)||(46395056-46395105)
chr3 (167-207)||(7085888-7085928)
chr3 (167-243)||(18904132-18904207)
chr3 (160-207)||(3682130-3682177)
chr3 (160-207)||(5947631-5947678)
chr3 (160-207)||(6200022-6200069)
chr3 (160-207)||(8622035-8622082)
chr3 (160-207)||(13107374-13107421)
chr3 (167-246)||(13108106-13108185)
chr3 (160-207)||(15531757-15531804)
chr3 (160-207)||(15580953-15581000)
chr3 (55-110)||(15624563-15624618)
chr3 (160-207)||(15921850-15921897)
chr3 (160-203)||(22962784-22962827)
chr3 (160-207)||(30018689-30018736)
chr3 (55-110)||(41002927-41002982)
chr3 (55-110)||(41011708-41011763)
chr3 (160-207)||(46383727-46383774)
chr3 (165-243)||(4690057-4690135)
chr3 (165-243)||(5658543-5658621)
chr3 (160-202)||(11922203-11922245)
chr3 (53-103)||(15707153-15707203)
chr3 (165-243)||(15734883-15734961)
chr3 (165-243)||(16422596-16422674)
chr3 (165-243)||(28109721-28109799)
chr3 (165-243)||(35887172-35887250)
chr3 (53-110)||(71829-71886)
chr3 (167-208)||(72641-72682)
chr3 (158-195)||(266301-266338)
chr3 (53-110)||(3408705-3408762)
chr3 (53-110)||(3681413-3681470)
chr3 (165-202)||(7085960-7085997)
chr3 (53-110)||(8609891-8609948)
chr3 (167-208)||(8622098-8622139)
chr3 (55-100)||(10718148-10718193)
chr3 (167-208)||(12573655-12573696)
chr3 (167-208)||(13550119-13550160)
chr3 (167-208)||(15531697-15531738)
chr3 (167-208)||(21613643-21613684)
chr3 (53-110)||(30017969-30018026)
chr3 (167-208)||(37257511-37257552)
chr3 (53-110)||(37258241-37258298)
chr3 (167-208)||(41003794-41003835)
chr3 (167-208)||(41012575-41012616)
chr3 (167-207)||(8810108-8810148)
chr3 (165-229)||(12553910-12553974)
chr3 (158-206)||(15679776-15679824)
chr3 (167-207)||(15921916-15921956)
[»] chr8 (91 HSPs)
chr8 (12-307)||(27603181-27603473)
chr8 (18-307)||(19693747-19694030)
chr8 (18-307)||(28356234-28356520)
chr8 (18-310)||(19655625-19655911)
chr8 (21-307)||(19202648-19202930)
chr8 (18-307)||(12087005-12087291)
chr8 (18-310)||(15773220-15773509)
chr8 (20-307)||(33248018-33248299)
chr8 (18-307)||(9360273-9360557)
chr8 (18-307)||(29834973-29835258)
chr8 (18-310)||(16259866-16260158)
chr8 (20-307)||(31484155-31484439)
chr8 (18-307)||(18715132-18715417)
chr8 (18-307)||(19680095-19680383)
chr8 (18-307)||(33264382-33264666)
chr8 (18-310)||(22138553-22138842)
chr8 (20-307)||(2131545-2131828)
chr8 (18-307)||(14568807-14569092)
chr8 (18-307)||(21342452-21342739)
chr8 (20-307)||(18796352-18796639)
chr8 (18-307)||(31360177-31360463)
chr8 (18-307)||(44566632-44566916)
chr8 (18-307)||(19911445-19911730)
chr8 (43-310)||(22075235-22075496)
chr8 (165-310)||(14214660-14214805)
chr8 (165-310)||(22414559-22414704)
chr8 (187-307)||(16288601-16288721)
chr8 (160-251)||(19847523-19847615)
chr8 (165-310)||(16770944-16771091)
chr8 (165-310)||(19846784-19846933)
chr8 (167-243)||(16771686-16771762)
chr8 (165-246)||(28355639-28355720)
chr8 (167-243)||(25794054-25794130)
chr8 (165-208)||(31483493-31483536)
chr8 (165-243)||(31483559-31483637)
chr8 (165-243)||(33265172-33265250)
chr8 (165-206)||(9361159-9361200)
chr8 (165-206)||(12086346-12086387)
chr8 (165-206)||(19654968-19655009)
chr8 (165-206)||(19694643-19694684)
chr8 (165-206)||(22074552-22074593)
chr8 (165-206)||(22139439-22139480)
chr8 (165-206)||(27602537-27602578)
chr8 (165-206)||(28355573-28355614)
chr8 (165-206)||(33248917-33248958)
chr8 (165-206)||(33265275-33265316)
chr8 (160-246)||(17677678-17677765)
chr8 (160-243)||(22158751-22158834)
chr8 (164-243)||(29835771-29835850)
chr8 (160-246)||(39840292-39840379)
chr8 (165-243)||(18715931-18716009)
chr8 (165-203)||(18797262-18797300)
chr8 (165-243)||(21341859-21341937)
chr8 (165-243)||(31360977-31361055)
chr8 (169-206)||(2130894-2130931)
chr8 (165-206)||(14569707-14569748)
chr8 (165-206)||(15774126-15774167)
chr8 (165-206)||(18716034-18716075)
chr8 (165-206)||(19680999-19681040)
chr8 (165-206)||(19910785-19910826)
chr8 (165-206)||(21341793-21341834)
chr8 (167-208)||(22090985-22091026)
chr8 (165-206)||(29835874-29835915)
chr8 (165-206)||(31361080-31361121)
chr8 (165-206)||(44567535-44567576)
chr8 (165-243)||(12086412-12086490)
chr8 (165-243)||(15774023-15774101)
chr8 (165-243)||(19202064-19202142)
chr8 (165-243)||(19655034-19655112)
chr8 (165-243)||(19680896-19680974)
chr8 (165-243)||(22139336-22139414)
chr8 (165-243)||(27602603-27602681)
chr8 (158-208)||(39840219-39840269)
chr8 (165-243)||(44567432-44567510)
chr8 (165-198)||(16260472-16260505)
chr8 (167-208)||(17677613-17677654)
chr8 (167-204)||(19202000-19202037)
chr8 (165-246)||(32003888-32003969)
chr8 (165-246)||(33248811-33248892)
chr8 (160-243)||(21477810-21477894)
chr8 (167-206)||(19847637-19847676)
chr8 (180-243)||(22074633-22074696)
chr8 (167-246)||(22159456-22159535)
chr8 (160-202)||(14215407-14215449)
chr8 (165-243)||(18797156-18797234)
chr8 (165-243)||(19694540-19694618)
chr8 (53-103)||(19846883-19846933)
chr8 (165-243)||(19910851-19910929)
chr8 (165-207)||(20731824-20731866)
chr8 (55-100)||(17678418-17678463)
chr8 (167-203)||(22415411-22415447)
[»] scaffold0237 (3 HSPs)
scaffold0237 (18-307)||(9247-9535)
scaffold0237 (165-243)||(8656-8734)
scaffold0237 (165-206)||(8590-8631)
[»] chr4 (118 HSPs)
chr4 (17-310)||(1905910-1906200)
chr4 (18-307)||(20332742-20333028)
chr4 (18-307)||(30759422-30759710)
chr4 (18-307)||(33668120-33668408)
chr4 (18-307)||(54839053-54839338)
chr4 (18-307)||(5700197-5700486)
chr4 (21-307)||(40099959-40100244)
chr4 (18-307)||(6575520-6575808)
chr4 (18-307)||(21975363-21975647)
chr4 (18-307)||(17018708-17018998)
chr4 (18-307)||(14753812-14754099)
chr4 (18-307)||(24586681-24586968)
chr4 (18-310)||(15233475-15233763)
chr4 (18-307)||(5011537-5011823)
chr4 (18-307)||(14670675-14670962)
chr4 (18-307)||(36338837-36339124)
chr4 (18-307)||(39856299-39856583)
chr4 (18-304)||(31120833-31121116)
chr4 (18-307)||(14104205-14104490)
chr4 (18-307)||(18794936-18795221)
chr4 (18-307)||(18311498-18311785)
chr4 (43-310)||(15276976-15277237)
chr4 (24-307)||(24118324-24118602)
chr4 (18-307)||(27157634-27157924)
chr4 (18-307)||(34183281-34183565)
chr4 (43-310)||(15380582-15380853)
chr4 (165-310)||(19769974-19770119)
chr4 (165-310)||(14723288-14723433)
chr4 (160-246)||(33184035-33184121)
chr4 (167-246)||(1878924-1879004)
chr4 (165-264)||(1879594-1879694)
chr4 (167-310)||(22144057-22144203)
chr4 (167-246)||(26215272-26215352)
chr4 (160-243)||(55791643-55791726)
chr4 (165-262)||(12517536-12517633)
chr4 (160-246)||(8097806-8097893)
chr4 (160-243)||(20558776-20558859)
chr4 (165-243)||(39857095-39857173)
chr4 (165-246)||(3384854-3384935)
chr4 (165-206)||(6576418-6576459)
chr4 (165-206)||(14105105-14105146)
chr4 (165-206)||(14671576-14671617)
chr4 (165-206)||(14753155-14753196)
chr4 (165-246)||(14753221-14753302)
chr4 (165-206)||(15234383-15234424)
chr4 (165-206)||(15276290-15276331)
chr4 (165-206)||(15379899-15379940)
chr4 (165-206)||(17019612-17019653)
chr4 (165-206)||(18794281-18794322)
chr4 (165-206)||(21976267-21976308)
chr4 (165-206)||(24119225-24119266)
chr4 (165-206)||(30760325-30760366)
chr4 (165-206)||(31120171-31120212)
chr4 (165-246)||(31120237-31120318)
chr4 (165-206)||(33667464-33667505)
chr4 (165-206)||(34182625-34182666)
chr4 (165-206)||(36323977-36324018)
chr4 (165-206)||(36338186-36338227)
chr4 (165-206)||(40099297-40099338)
chr4 (165-206)||(54839954-54839995)
chr4 (165-208)||(1674422-1674465)
chr4 (165-208)||(1906821-1906864)
chr4 (160-230)||(3830507-3830577)
chr4 (165-243)||(5701000-5701078)
chr4 (165-243)||(27157039-27157117)
chr4 (165-243)||(30760222-30760300)
chr4 (165-243)||(33667530-33667608)
chr4 (165-246)||(3361388-3361469)
chr4 (165-206)||(5012441-5012482)
chr4 (165-206)||(5701103-5701144)
chr4 (165-246)||(15895497-15895578)
chr4 (165-246)||(21976161-21976242)
chr4 (165-206)||(27156973-27157014)
chr4 (165-206)||(39857198-39857239)
chr4 (162-262)||(55786813-55786914)
chr4 (160-243)||(9189190-9189274)
chr4 (167-251)||(15570124-15570208)
chr4 (167-251)||(15574252-15574336)
chr4 (180-243)||(17019509-17019572)
chr4 (160-203)||(19770709-19770752)
chr4 (167-246)||(20558059-20558138)
chr4 (165-240)||(36324044-36324119)
chr4 (165-240)||(36338253-36338328)
chr4 (167-246)||(39531596-39531675)
chr4 (180-246)||(5012335-5012401)
chr4 (165-243)||(6576315-6576393)
chr4 (165-243)||(14105002-14105080)
chr4 (165-243)||(14671473-14671551)
chr4 (213-310)||(17296937-17297035)
chr4 (165-243)||(24119122-24119200)
chr4 (165-243)||(34182691-34182769)
chr4 (165-243)||(40099363-40099441)
chr4 (53-110)||(3361412-3361469)
chr4 (53-110)||(3362109-3362166)
chr4 (53-110)||(3362806-3362863)
chr4 (167-208)||(3363588-3363629)
chr4 (167-208)||(8097745-8097786)
chr4 (179-243)||(22709719-22709784)
chr4 (167-207)||(14722583-14722623)
chr4 (165-229)||(16723181-16723245)
chr4 (160-223)||(3363503-3363566)
chr4 (55-110)||(8098581-8098636)
chr4 (165-208)||(20332084-20332127)
chr4 (165-208)||(24586022-24586065)
chr4 (165-240)||(54839854-54839929)
chr4 (165-223)||(3362108-3362166)
chr4 (165-223)||(3362805-3362863)
chr4 (160-202)||(14722650-14722692)
chr4 (53-107)||(14723288-14723342)
chr4 (165-223)||(14875020-14875078)
chr4 (165-243)||(15379965-15380043)
chr4 (53-103)||(55786861-55786911)
chr4 (165-230)||(14923165-14923230)
chr4 (167-208)||(14923248-14923289)
chr4 (167-208)||(15894723-15894764)
chr4 (167-208)||(22709820-22709861)
chr4 (167-208)||(33184142-33184183)
chr4 (167-207)||(12616580-12616620)
[»] chr2 (150 HSPs)
chr2 (18-307)||(3788141-3788427)
chr2 (18-307)||(13930855-13931143)
chr2 (21-307)||(34269232-34269516)
chr2 (18-307)||(9344296-9344582)
chr2 (18-307)||(20843561-20843846)
chr2 (18-307)||(32055451-32055736)
chr2 (18-307)||(34296802-34297090)
chr2 (18-310)||(21697484-21697769)
chr2 (21-307)||(37931017-37931302)
chr2 (18-307)||(12592456-12592743)
chr2 (18-307)||(12661185-12661472)
chr2 (18-307)||(27428755-27429037)
chr2 (18-307)||(34160492-34160777)
chr2 (18-307)||(37383325-37383610)
chr2 (18-307)||(39895717-39896001)
chr2 (18-307)||(37680202-37680491)
chr2 (18-307)||(37695467-37695756)
chr2 (18-307)||(27122172-27122458)
chr2 (18-307)||(27809351-27809634)
chr2 (20-307)||(16167128-16167409)
chr2 (18-307)||(21671482-21671771)
chr2 (18-307)||(254961-255249)
chr2 (18-307)||(11629493-11629780)
chr2 (18-307)||(28887927-28888212)
chr2 (18-307)||(31881934-31882220)
chr2 (18-307)||(37946175-37946458)
chr2 (18-307)||(39046131-39046415)
chr2 (19-307)||(22922455-22922744)
chr2 (18-304)||(16823649-16823931)
chr2 (18-304)||(16897549-16897831)
chr2 (22-307)||(12710914-12711197)
chr2 (18-307)||(27781882-27782165)
chr2 (18-307)||(27821639-27821922)
chr2 (18-307)||(34867332-34867616)
chr2 (18-307)||(40239156-40239442)
chr2 (21-307)||(23122885-23123165)
chr2 (18-307)||(31887802-31888087)
chr2 (43-310)||(19450761-19451022)
chr2 (43-274)||(27396001-27396231)
chr2 (158-307)||(19410948-19411097)
chr2 (18-138)||(19410796-19410916)
chr2 (165-310)||(42396156-42396301)
chr2 (165-310)||(34703697-34703842)
chr2 (165-264)||(34531927-34532027)
chr2 (165-263)||(22952060-22952159)
chr2 (165-310)||(26721752-26721899)
chr2 (165-246)||(13930261-13930342)
chr2 (165-246)||(39045537-39045618)
chr2 (167-243)||(26721081-26721157)
chr2 (160-246)||(3761100-3761187)
chr2 (167-243)||(34531245-34531321)
chr2 (160-246)||(42569227-42569314)
chr2 (165-243)||(22921860-22921938)
chr2 (165-206)||(254303-254344)
chr2 (165-206)||(9343638-9343679)
chr2 (165-206)||(12593364-12593405)
chr2 (165-206)||(12662041-12662082)
chr2 (165-206)||(12710252-12710293)
chr2 (165-206)||(16168028-16168069)
chr2 (165-206)||(16822988-16823029)
chr2 (165-246)||(16823054-16823135)
chr2 (165-246)||(16898345-16898426)
chr2 (165-206)||(16898451-16898492)
chr2 (165-206)||(19450069-19450110)
chr2 (165-206)||(20844464-20844505)
chr2 (165-206)||(22921794-22921835)
chr2 (165-206)||(23122227-23122268)
chr2 (165-206)||(27396886-27396927)
chr2 (165-206)||(27782780-27782821)
chr2 (165-206)||(27810253-27810294)
chr2 (165-206)||(31868437-31868478)
chr2 (165-206)||(32056303-32056344)
chr2 (165-206)||(34161396-34161437)
chr2 (165-206)||(34868184-34868225)
chr2 (165-206)||(37945516-37945557)
chr2 (165-206)||(40240058-40240099)
chr2 (160-246)||(21854655-21854742)
chr2 (167-206)||(28888804-28888843)
chr2 (160-246)||(35144016-35144103)
chr2 (165-243)||(11628902-11628980)
chr2 (165-243)||(12593261-12593339)
chr2 (165-243)||(16167925-16168003)
chr2 (165-243)||(19410201-19410279)
chr2 (165-243)||(23122293-23122371)
chr2 (165-246)||(24290500-24290582)
chr2 (165-243)||(27122970-27123048)
chr2 (165-243)||(37384124-37384202)
chr2 (165-243)||(37931826-37931904)
chr2 (165-243)||(40239955-40240033)
chr2 (159-208)||(12387033-12387082)
chr2 (165-206)||(19410135-19410176)
chr2 (165-206)||(23117347-23117388)
chr2 (165-206)||(27123073-27123114)
chr2 (165-206)||(27428104-27428145)
chr2 (165-206)||(31882836-31882877)
chr2 (169-206)||(34268581-34268618)
chr2 (165-206)||(34297699-34297740)
chr2 (165-206)||(37384227-37384268)
chr2 (165-206)||(37679542-37679583)
chr2 (165-206)||(37694807-37694848)
chr2 (165-206)||(37931929-37931970)
chr2 (165-206)||(39896618-39896659)
chr2 (166-206)||(21670821-21670861)
chr2 (160-246)||(16278892-16278979)
chr2 (168-243)||(31882733-31882808)
chr2 (165-243)||(254369-254447)
chr2 (165-243)||(12710318-12710396)
chr2 (165-243)||(19450135-19450213)
chr2 (165-243)||(23117243-23117321)
chr2 (158-208)||(25500111-25500161)
chr2 (165-243)||(27428170-27428248)
chr2 (165-243)||(27810150-27810228)
chr2 (165-243)||(28888701-28888779)
chr2 (165-243)||(34161293-34161371)
chr2 (165-243)||(34268643-34268721)
chr2 (165-243)||(37945582-37945660)
chr2 (165-243)||(39896515-39896593)
chr2 (167-208)||(3761036-3761077)
chr2 (165-206)||(3788995-3789036)
chr2 (165-206)||(11628836-11628877)
chr2 (167-208)||(15947690-15947731)
chr2 (165-206)||(21696837-21696878)
chr2 (167-208)||(42569166-42569207)
chr2 (165-229)||(20277448-20277512)
chr2 (165-241)||(21670886-21670962)
chr2 (179-262)||(21753149-21753233)
chr2 (165-241)||(37679608-37679684)
chr2 (165-241)||(37694873-37694949)
chr2 (160-207)||(12386908-12386955)
chr2 (160-207)||(12386971-12387018)
chr2 (160-246)||(15947752-15947838)
chr2 (55-110)||(15948523-15948578)
chr2 (55-110)||(21117682-21117737)
chr2 (160-246)||(25499999-25500086)
chr2 (55-110)||(35143261-35143316)
chr2 (160-203)||(42396890-42396933)
chr2 (55-110)||(42569999-42570054)
chr2 (160-202)||(3760078-3760120)
chr2 (165-243)||(20844361-20844439)
chr2 (165-243)||(21696903-21696981)
chr2 (53-103)||(21758096-21758146)
chr2 (165-235)||(24694112-24694182)
chr2 (165-243)||(27396783-27396861)
chr2 (167-208)||(16279002-16279043)
chr2 (167-208)||(20616246-20616287)
chr2 (53-110)||(21753135-21753192)
chr2 (55-100)||(24289786-24289831)
chr2 (167-208)||(24290606-24290647)
chr2 (167-235)||(20615361-20615429)
chr2 (179-262)||(21758110-21758193)
[»] scaffold0143 (7 HSPs)
scaffold0143 (18-310)||(32939-33232)
scaffold0143 (18-197)||(9671-9849)
scaffold0143 (213-307)||(9609-9703)
scaffold0143 (165-206)||(33847-33888)
scaffold0143 (166-206)||(10466-10506)
scaffold0143 (165-243)||(10363-10441)
scaffold0143 (165-243)||(33744-33822)
[»] scaffold0038 (3 HSPs)
scaffold0038 (18-307)||(13598-13884)
scaffold0038 (165-206)||(14502-14543)
scaffold0038 (165-243)||(14399-14477)
[»] scaffold0418 (3 HSPs)
scaffold0418 (18-307)||(11685-11973)
scaffold0418 (165-206)||(12587-12628)
scaffold0418 (165-243)||(12484-12562)
[»] scaffold0336 (3 HSPs)
scaffold0336 (18-307)||(15220-15504)
scaffold0336 (165-243)||(16025-16103)
scaffold0336 (165-206)||(16128-16169)
[»] scaffold0322 (6 HSPs)
scaffold0322 (18-307)||(1307-1592)
scaffold0322 (18-310)||(11691-11982)
scaffold0322 (165-246)||(2103-2184)
scaffold0322 (165-206)||(2209-2250)
scaffold0322 (165-243)||(12493-12571)
scaffold0322 (165-206)||(12596-12637)
[»] scaffold0288 (1 HSPs)
scaffold0288 (18-307)||(28-312)
[»] scaffold0159 (6 HSPs)
scaffold0159 (18-307)||(3500-3786)
scaffold0159 (168-307)||(13263-13402)
scaffold0159 (165-206)||(2840-2881)
scaffold0159 (165-206)||(18360-18401)
scaffold0159 (165-243)||(2906-2984)
scaffold0159 (165-243)||(18257-18335)
[»] scaffold0089 (3 HSPs)
scaffold0089 (18-307)||(5716-6001)
scaffold0089 (165-206)||(6615-6656)
scaffold0089 (165-243)||(6512-6590)
[»] scaffold0254 (1 HSPs)
scaffold0254 (20-307)||(18231-18518)
[»] scaffold0240 (2 HSPs)
scaffold0240 (18-307)||(25221-25506)
scaffold0240 (165-206)||(24615-24656)
[»] scaffold0792 (2 HSPs)
scaffold0792 (18-307)||(4925-5213)
scaffold0792 (165-206)||(4262-4304)
[»] scaffold0144 (2 HSPs)
scaffold0144 (18-307)||(20512-20798)
scaffold0144 (160-244)||(9089-9174)
[»] scaffold0109 (3 HSPs)
scaffold0109 (43-310)||(24762-25025)
scaffold0109 (165-206)||(25674-25715)
scaffold0109 (165-243)||(25571-25649)
[»] scaffold0415 (1 HSPs)
scaffold0415 (51-307)||(11672-11934)
[»] scaffold0242 (1 HSPs)
scaffold0242 (86-310)||(130-351)
[»] scaffold0547 (4 HSPs)
scaffold0547 (18-197)||(9959-10135)
scaffold0547 (213-307)||(10103-10197)
scaffold0547 (165-206)||(9303-9344)
scaffold0547 (165-243)||(9369-9447)
[»] scaffold0404 (3 HSPs)
scaffold0404 (167-310)||(12840-12983)
scaffold0404 (160-202)||(13583-13625)
scaffold0404 (160-202)||(13741-13783)
[»] scaffold0031 (3 HSPs)
scaffold0031 (165-310)||(15879-16028)
scaffold0031 (167-243)||(15201-15277)
scaffold0031 (165-230)||(27715-27780)
[»] scaffold0046 (2 HSPs)
scaffold0046 (165-307)||(51527-51675)
scaffold0046 (160-251)||(52254-52348)
[»] scaffold1837 (2 HSPs)
scaffold1837 (165-310)||(1168-1315)
scaffold1837 (167-243)||(527-607)
[»] scaffold0029 (5 HSPs)
scaffold0029 (165-263)||(31840-31939)
scaffold0029 (167-246)||(89661-89740)
scaffold0029 (165-218)||(8034-8087)
scaffold0029 (53-110)||(31882-31939)
scaffold0029 (167-207)||(90415-90455)
[»] scaffold0160 (2 HSPs)
scaffold0160 (165-310)||(32952-33095)
scaffold0160 (167-235)||(33702-33770)
[»] scaffold0799 (3 HSPs)
scaffold0799 (160-243)||(5226-5309)
scaffold0799 (162-262)||(228-329)
scaffold0799 (53-103)||(276-326)
[»] scaffold0257 (3 HSPs)
scaffold0257 (160-246)||(150-237)
scaffold0257 (179-208)||(247-276)
scaffold0257 (55-84)||(259-288)
[»] scaffold0044 (2 HSPs)
scaffold0044 (160-246)||(69111-69198)
scaffold0044 (167-208)||(69047-69088)
[»] scaffold0306 (2 HSPs)
scaffold0306 (165-246)||(19302-19383)
scaffold0306 (53-110)||(19326-19383)
[»] scaffold0157 (1 HSPs)
scaffold0157 (165-262)||(3278-3375)
[»] scaffold0114 (2 HSPs)
scaffold0114 (165-246)||(30027-30108)
scaffold0114 (167-207)||(29251-29291)
[»] scaffold1418 (3 HSPs)
scaffold1418 (160-246)||(1400-1487)
scaffold1418 (160-244)||(422-507)
scaffold1418 (167-208)||(1336-1377)
[»] scaffold0605 (3 HSPs)
scaffold0605 (160-246)||(3371-3458)
scaffold0605 (167-208)||(3311-3352)
scaffold0605 (55-110)||(4141-4196)
[»] scaffold0357 (2 HSPs)
scaffold0357 (167-246)||(10460-10539)
scaffold0357 (160-243)||(11160-11243)
[»] scaffold0132 (3 HSPs)
scaffold0132 (160-243)||(28331-28414)
scaffold0132 (165-246)||(27616-27697)
scaffold0132 (165-246)||(32596-32677)
[»] scaffold0015 (1 HSPs)
scaffold0015 (160-246)||(173139-173226)
[»] scaffold0099 (2 HSPs)
scaffold0099 (18-139)||(40974-41105)
scaffold0099 (198-306)||(41173-41292)
[»] scaffold0014 (5 HSPs)
scaffold0014 (165-251)||(1603-1689)
scaffold0014 (160-246)||(2333-2419)
scaffold0014 (160-243)||(181803-181886)
scaffold0014 (53-110)||(1632-1689)
scaffold0014 (167-208)||(2437-2478)
[»] scaffold0582 (3 HSPs)
scaffold0582 (165-246)||(3601-3682)
scaffold0582 (160-243)||(2882-2965)
scaffold0582 (53-110)||(3601-3658)
[»] scaffold0019 (4 HSPs)
scaffold0019 (165-206)||(154914-154955)
scaffold0019 (160-243)||(15195-15279)
scaffold0019 (165-246)||(15932-16013)
scaffold0019 (53-110)||(15932-15989)
[»] scaffold0094 (1 HSPs)
scaffold0094 (165-262)||(32738-32837)
[»] scaffold0083 (1 HSPs)
scaffold0083 (167-246)||(20955-21035)
[»] scaffold0451 (1 HSPs)
scaffold0451 (160-246)||(185-272)
[»] scaffold0389 (1 HSPs)
scaffold0389 (160-246)||(5201-5288)
[»] scaffold0068 (2 HSPs)
scaffold0068 (167-246)||(21180-21259)
scaffold0068 (159-208)||(20394-20443)
[»] scaffold0016 (2 HSPs)
scaffold0016 (160-246)||(21010-21097)
scaffold0016 (159-208)||(21114-21163)
[»] scaffold0243 (2 HSPs)
scaffold0243 (165-246)||(18565-18646)
scaffold0243 (167-208)||(19320-19361)
[»] scaffold0093 (2 HSPs)
scaffold0093 (165-206)||(326-367)
scaffold0093 (167-243)||(223-299)
[»] scaffold0320 (1 HSPs)
scaffold0320 (167-246)||(2660-2739)
[»] scaffold0009 (1 HSPs)
scaffold0009 (165-293)||(154976-155101)
[»] scaffold0721 (2 HSPs)
scaffold0721 (179-243)||(5530-5595)
scaffold0721 (167-208)||(5453-5494)
[»] scaffold0441 (1 HSPs)
scaffold0441 (165-246)||(8050-8131)
[»] scaffold0125 (2 HSPs)
scaffold0125 (165-246)||(13332-13413)
scaffold0125 (160-207)||(14065-14112)
[»] scaffold1056 (1 HSPs)
scaffold1056 (167-207)||(1168-1208)
[»] scaffold0932 (1 HSPs)
scaffold0932 (167-243)||(3736-3812)
[»] scaffold1691 (2 HSPs)
scaffold1691 (55-110)||(397-452)
scaffold1691 (167-246)||(1157-1237)
[»] scaffold1661 (1 HSPs)
scaffold1661 (167-246)||(1171-1250)
[»] scaffold0047 (2 HSPs)
scaffold0047 (160-202)||(79686-79728)
scaffold0047 (167-205)||(79761-79799)
[»] scaffold0183 (1 HSPs)
scaffold0183 (165-230)||(33404-33469)
[»] scaffold0004 (1 HSPs)
scaffold0004 (165-246)||(190609-190690)
[»] scaffold0327 (1 HSPs)
scaffold0327 (159-207)||(16403-16451)


Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 181)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 12 - 310
Target Start/End: Original strand, 27623968 - 27624264
Alignment:
Q  12 tgatgtgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27623968 tgatttgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 27624067  T
Q  112 agttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 211  Q
    ||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27624068 agttgcgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 27624165  T
Q  212 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27624166 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 27624264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 27284627 - 27284917
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||    
T  27284627 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcatttttgcctgagttgc 27284726  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27284727 gtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27284824  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27284825 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 27284917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27013665 - 27013378
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27013665 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27013566  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27013565 gtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27013468  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27013467 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27013378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13293211 - 13293501
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  13293211 gccagatatagttacttgccttttgtttcaatctcctttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 13293310  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||||||||||||||||||||||||||| |          | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  13293311 gtacaatctcagcgagctttttcatatatttctttttttgtgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 13293410  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  13293411 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 13293501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4763696 - 4763409
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  4763696 gccagatatagttacttgccttttgtttcaatctcatttttgtatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 4763597  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4763596 gtacaatctcagcgagctttt-catatttgttttttcttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 4763499  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4763498 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4763409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 16938291 - 16938577
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  16938291 gccagatatagttacttgccttttatttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 16938390  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16938391 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16938487  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  16938488 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 16938577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28213386 - 28213100
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  28213386 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 28213287  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28213286 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28213190  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  28213189 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 28213100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 29555490 - 29555204
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  29555490 gccagatatagttacttgcctttggtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 29555391  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29555390 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 29555294  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  29555293 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 29555204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 8899965 - 8900253
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  8899965 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 8900064  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  8900065 atacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 8900163  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  8900164 tgcctaggccgccctttcggattttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 8900253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13518459 - 13518744
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||| |||||||||||||    
T  13518459 gccagatatagttacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcatttttgcctgagttgc 13518558  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    | ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  13518559 gaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 13518654  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  13518655 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 13518744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 22929148 - 22929434
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22929148 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 22929247  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     ||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  22929248 atacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 22929344  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  22929345 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 22929434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 23851593 - 23851879
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23851593 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 23851692  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     ||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  23851693 atacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 23851789  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  23851790 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 23851879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 24869642 - 24869356
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  24869642 gccagatatagttacttgccttttgtttcaatctcatttttccatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 24869543  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24869542 gtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24869446  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  24869445 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 24869356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27200118 - 27199831
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27200118 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27200019  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27200018 gtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27199921  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27199920 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27199831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 27249116 - 27249403
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27249116 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27249215  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27249216 gtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27249313  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27249314 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27249403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 27264380 - 27264664
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27264380 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27264479  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     | |||||||||||||||||||||| |||           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27264480 atgcaatctcagcgagctttttcattttttttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27264574  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27264575 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27264664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 29507348 - 29507062
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  29507348 gccagatatagttatttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 29507249  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29507248 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 29507152  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  29507151 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 29507062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 29578947 - 29578660
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  29578947 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 29578848  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29578847 gtacaatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 29578750  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  29578749 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 29578660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27063414 - 27063129
Alignment:
Q  18 gccagatatagttacttgcctttt-gtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttg 116  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  27063414 gccagatatagttacttgcctttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttg 27063315  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
     ||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  27063314 tgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 27063220  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27063219 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27063129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 4718401 - 4718685
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
T  4718401 gccagatatagttacttgccttttgtttcaatcttatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgc 4718500  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4718501 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 4718595  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  4718596 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 4718685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 26110676 - 26110962
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||     
T  26110676 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacactcattcttgcctgagttgt 26110775  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||    
T  26110776 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttctcgatccaccgggaagcgcatttt 26110872  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26110873 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26110962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 26926702 - 26926416
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  26926702 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 26926603  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26926602 gtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26926506  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26926505 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26926416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 27356377 - 27356660
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  27356377 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 27356476  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27356477 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27356570  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27356571 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27356660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 34458772 - 34459056
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  34458772 gccagatatagttacttgcctttcatttcaatctcgtttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 34458871  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  34458872 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 34458966  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  34458967 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 34459056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4531220 - 4530931
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||     
T  4531220 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgaccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 4531121  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||||||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4531120 gtacaatctcagcgagctttt-catatttgttgttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 4531022  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  4531021 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 4530931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27184860 - 27184575
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27184860 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27184761  T
Q  118 gtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
     | ||||||||||||||||||| ||| |||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  27184760 atgcaatctcagcgagcttttttcattttttttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 27184666  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27184665 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27184575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4778812 - 4778526
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  4778812 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 4778713  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4778712 gtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 4778616  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4778615 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4778526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27491065 - 27490779
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27491065 gccagatatagttacttgccttctgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27490966  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
T  27490965 gtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttacctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27490869  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27490868 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27490779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 33370697 - 33370981
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  33370697 gccagatatagttacttgccttttgtttcaatctcatttttgcctgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 33370796  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||| ||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  33370797 gtataatctcagcgagctttt-catatttgttttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 33370891  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  33370892 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 33370981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27030954 - 27030669
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcgg-ctcatcgagacgctcattcttgcctgagttg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
T  27030954 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggtctcatcgagacgctcattcttgcctgagttg 27030855  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
     ||||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  27030854 tgtacaatctcagcgagctttttcatatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 27030760  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| || ||||||||    
T  27030759 ttgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatgtcggcattcac 27030669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28166426 - 28166137
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |  |||||||||||||||||||||||||||||||    
T  28166426 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggtttttgattcatcgagacgctcattcttgcctgagttgc 28166327  T
Q  118 gtacaatctcagcgagctttttc-atatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    |||||||| |||||||||||||  |||||||         | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  28166326 gtacaatcccagcgagctttttttatatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 28166228  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28166227 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28166137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 14139660 - 14139944
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  14139660 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 14139759  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          ||||||||||||| |||||| ||||||||||||||| | |||||||||||||||||||||    
T  14139760 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttattttttcctggaccgccctttcgggtttaccatccaccgggaagcgcatttt 14139854  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  14139855 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 14139944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 16755752 - 16755467
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  16755752 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 16755653  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||    
T  16755652 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaggcgcatttt 16755557  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||| || |||||    
T  16755556 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttgactatatcggcgttcac 16755467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 24300021 - 24300307
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||  |||||||||||||||||||||||||||||     
T  24300021 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggtccatcgagacgctcattcttgcctgagttgt 24300120  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24300121 gtacaatctcagcgagctttt-catatatttttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24300217  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  24300218 tgcctaggccgccctttcggattttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 24300307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 26772894 - 26773177
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  26772894 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 26772993  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  26772994 atacaatctcagcgagctttt-catatttgtttttt----gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26773087  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  26773088 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 26773177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 26791748 - 26791462
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||   ||||||||||||||||||||||||||||||    
T  26791748 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgatccatcgagacgctcattcttgcctgagttgc 26791649  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26791648 ctgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26791552  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26791551 tgcctaggccgccctttcgggttttcgacctaccacgttgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26791462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 30552282 - 30552566
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  30552282 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 30552381  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  30552382 ttacaatctcagcgagctttt-catatatattttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 30552476  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  30552477 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 30552566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 15406796 - 15407083
Alignment:
Q  19 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||     
T  15406796 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgca 15406895  T
Q  119 tacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    | ||||| ||||||||||||| ||||             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  15406896 tgcaatcgcagcgagcttttt-atataatttttttttgtgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattttt 15406994  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  15406995 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 15407083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 15418583 - 15418870
Alignment:
Q  19 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||     
T  15418583 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgca 15418682  T
Q  119 tacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    | ||||| ||||||||||||| ||||             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  15418683 tgcaatcgcagcgagcttttt-atataatttttttttgtgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattttt 15418781  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  15418782 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 15418870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 24 - 307
Target Start/End: Complemental strand, 16680065 - 16679786
Alignment:
Q  24 tatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaa 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||| ||||    
T  16680065 tatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgcgcacaa 16679966  T
Q  124 tctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct 222  Q
    |||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  16679965 tctcagcgagcttttttcatatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcct 16679871  T
Q  223 aggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  16679870 aggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 16679786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 4540025 - 4540324
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  4540025 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 4540124  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-----------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||| ||||||||                     |||||||||||||||||||| ||||||||||||||||||||||| ||||    
T  4540125 gtacaatctcagcgagctttt-catatttgtttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccatcggg 4540223  T
Q  207 aagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattca 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| |||||||    
T  4540224 aagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattca 4540323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 27025077 - 27024780
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||     
T  27025077 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgt 27024978  T
Q  118 gtacaatctcagcgagctttttcatat----ttgnnnnnnnnnggtccctt-atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc 212  Q
    ||||||||||||||||  |||  ||||    ||           ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
T  27024977 gtacaatctcagcgagtctttatatatattatttattttttttcgtccctttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgc 27024878  T
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||    
T  27024877 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatgtctaggcaaagtatttcttgactatatcagcattcacagg 27024780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 25 - 308
Target Start/End: Complemental strand, 20174474 - 20174192
Alignment:
Q  25 atagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaat 124  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||    
T  20174474 atagttacttgccttttgtttcaatctcattttttcatgaaccgccctttcgggttttcggttcattgagacgctcatttttgcctgagttgcgtacaat 20174375  T
Q  125 ctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctag 224  Q
    |||||||||||||| ||||||            |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||    
T  20174374 ctcagcgagctttt-catattcattctgttttagtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatttttgcctag 20174276  T
Q  225 gccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcaca 308  Q
    ||||||||||||| |||||||||| |||||||||||||||||||| | ||||| ||||||||||||| ||||||||||||||||    
T  20174275 gccgccctttcggattttcgacctgccacgctgttcttttcatatttttaggcaaagtatttcttgaatatatcagcattcaca 20174192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 25 - 308
Target Start/End: Original strand, 22161517 - 22161799
Alignment:
Q  25 atagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaat 124  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||    
T  22161517 atagttacttgccttttgtttcaatctcattttttcatgaaccgccctttcgggttttcggttcattgagacgctcatttttgcctgagttgcgtacaat 22161616  T
Q  125 ctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctag 224  Q
    |||||||||||||| ||||||            |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||    
T  22161617 ctcagcgagctttt-catattcattctgttttagtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatttttgcctag 22161715  T
Q  225 gccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcaca 308  Q
    ||||||||||||| |||||||||| |||||||||||||||||||| | ||||| ||||||||||||| ||||||||||||||||    
T  22161716 gccgccctttcggattttcgacctgccacgctgttcttttcatatttttaggcaaagtatttcttgaatatatcagcattcaca 22161799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 18210101 - 18210246
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  18210101 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 18210200  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  18210201 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 18210246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 21363070 - 21363215
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  21363070 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 21363169  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  21363170 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 21363215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 23967052 - 23967197
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  23967052 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 23967151  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  23967152 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 23967197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 167 - 310
Target Start/End: Complemental strand, 18122231 - 18122088
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttc 265  Q
    ||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  |||||||||||     
T  18122231 ttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttctttt- 18122133  T
Q  266 atatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  18122132 atatatttagacaaagtatttcttgactgcatcagaattcacagg 18122088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 25709720 - 25709573
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||| ||||||||||||||||||||||||  ||||||||||    
T  25709720 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggctgccctttcgggttttcgacctaccgagctgttcttt 25709621  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  25709620 tatacatatttagacaaagtatttcttgactgcatcagaattcacagg 25709573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 27547668 - 27547521
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  27547668 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 27547569  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  27547568 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 27547521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 25710345 - 25710269
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||| |||| ||||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  25710345 ttttgcatggaccgccctttcgggttttcaatccaccgggacgctcttttttgcctaagccgccctttcgggttttc 25710269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 27548335 - 27548259
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  27548335 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 27548259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 16584723 - 16584636
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  16584723 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 16584636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 16610657 - 16610744
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  16610657 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 16610744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 27515821 - 27515738
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| |||||| |||| |||||||    
T  27515821 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggttttc 27515738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 18752933 - 18753019
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||| |||||||||||||  |||| ||||| || |||||||||||| ||||||||| ||||||||||||    
T  18752933 ccctaatttttgcctggaccgcgctttcgggttttcagtccatcgggacgctcatttttgcctaagccgcccttacgggttttcgac 18753019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 16639697 - 16639612
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcg 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||    
T  16639697 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcg 16639612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 27623314 - 27623358
Alignment:
Q  164 tatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  27623314 tatttttgcctggatcgccctttcgggttttcgatccaccgggaa 27623358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 174410 - 174323
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  174410 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 174323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 27053474 - 27053561
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27053474 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 27053561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 15648234 - 15648320
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||| |||||| || |||||||||||||  ||||||||||| || |||||||||||| |||||| |||| ||||||||||    
T  15648234 ccctaattttttcctggaccgtcctttcgggtttttaatccaccgggacgctcatttttgcctaagccgccttttcaggttttcgac 15648320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27200710 - 27200632
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||||||||||||||||||||||||||    
T  27200710 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggccgccctttcgggttttc 27200632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27248523 - 27248601
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||||||||||||||||||||||||||    
T  27248523 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggccgccctttcgggttttc 27248601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27491656 - 27491578
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27491656 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27491578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 4539366 - 4539407
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4539366 atttttgcctggatcgccctttcgggttttcgatccaccggg 4539407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 8899307 - 8899348
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  8899307 atttttgcctggatcgccctttcgggttttcgatccaccggg 8899348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 8899373 - 8899454
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| || ||||||||||||| || || || ||||  || |||||||||||| ||||||||||||||||||||||    
T  8899373 atttttgcctgaattgccctttcgggttgtcaattcagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 8899454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 264
Target Start/End: Original strand, 9133783 - 9133884
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  9133783 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 9133882  T
Q  263 tt 264  Q
    ||    
T  9133883 tt 9133884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 14139008 - 14139049
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14139008 atttttgcctggatcgccctttcgggttttcgatccaccggg 14139049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15406141 - 15406182
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15406141 atttttgcctggatcgccctttcgggttttcgatccaccggg 15406182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15417928 - 15417969
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15417928 atttttgcctggatcgccctttcgggttttcgatccaccggg 15417969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16680729 - 16680688
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16680729 atttttgcctggatcgccctttcgggttttcgatccaccggg 16680688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16937633 - 16937674
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16937633 atttttgcctggatcgccctttcgggttttcgatccaccggg 16937674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22928488 - 22928529
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22928488 atttttgcctggatcgccctttcgggttttcgatccaccggg 22928529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 24299368 - 24299409
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24299368 atttttgcctggatcgccctttcgggttttcgatccaccggg 24299409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26110017 - 26110058
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26110017 atttttgcctggatcgccctttcgggttttcgatccaccggg 26110058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26666266 - 26666307
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26666266 atttttgcctggatcgccctttcgggttttcgatccaccggg 26666307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26772237 - 26772278
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26772237 atttttgcctggatcgccctttcgggttttcgatccaccggg 26772278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26927342 - 26927301
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26927342 atttttgcctggatcgccctttcgggttttcgatccaccggg 26927301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27014316 - 27014275
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27014316 atttttgcctggatcgccctttcgggttttcgatccaccggg 27014275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27031610 - 27031569
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27031610 atttttgcctggatcgccctttcgggttttcgatccaccggg 27031569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27064071 - 27064030
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27064071 atttttgcctggatcgccctttcgggttttcgatccaccggg 27064030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 27070573 - 27070654
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  27070573 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 27070654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27209490 - 27209449
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27209490 atttttgcctggatcgccctttcgggttttcgatccaccggg 27209449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27239738 - 27239779
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27239738 atttttgcctggatcgccctttcgggttttcgatccaccggg 27239779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27491722 - 27491681
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27491722 atttttgcctggatcgccctttcgggttttcgatccaccggg 27491681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28167085 - 28167044
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28167085 atttttgcctggatcgccctttcgggttttcgatccaccggg 28167044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28214045 - 28214004
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28214045 atttttgcctggatcgccctttcgggttttcgatccaccggg 28214004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 29508008 - 29507967
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29508008 atttttgcctggatcgccctttcgggttttcgatccaccggg 29507967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 29579604 - 29579563
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29579604 atttttgcctggatcgccctttcgggttttcgatccaccggg 29579563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 30551608 - 30551649
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30551608 atttttgcctggatcgccctttcgggttttcgatccaccggg 30551649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 33370039 - 33370080
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33370039 atttttgcctggatcgccctttcgggttttcgatccaccggg 33370080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 22775499 - 22775578
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  22775499 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 22775578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 28308828 - 28308741
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  28308828 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 28308741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4779405 - 4779327
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4779405 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4779327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 13517868 - 13517946
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  13517868 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 13517946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27355785 - 27355863
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27355785 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27355863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28167019 - 28166941
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28167019 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28166941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 29507942 - 29507864
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29507942 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29507864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 34458116 - 34458154
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  34458116 atttttgcctggatcgccctttcgggttttcgatccacc 34458154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4531878 - 4531837
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  4531878 atttttgcctggatcgccctttcgggttttcgacccaccggg 4531837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4764353 - 4764312
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  4764353 atttttgcctagatcgccctttcgggttttcgatccaccggg 4764312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4779471 - 4779430
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  4779471 atttttgcctggatcgccttttcgggttttcgatccaccggg 4779430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 13292557 - 13292598
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  13292557 atttttgcctggatcgccctttcgggttttcgacccaccggg 13292598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 13517802 - 13517843
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  13517802 atttttgcctggatcgccctctcgggttttcgatccaccggg 13517843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16756411 - 16756370
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  16756411 atttttgcctggatcgccctttcgggttttcgacccaccggg 16756370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 206
Target Start/End: Complemental strand, 24870291 - 24870254
Alignment:
Q  169 ttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||    
T  24870291 ttgcctggatcgccctttcgggttttcgatccaccggg 24870254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26792406 - 26792365
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  26792406 atttttgcctggatcgccctttcgggttttcgatccatcggg 26792365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27025732 - 27025691
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  27025732 atttttgcctggatcgccctttcgggttttcgatccatcggg 27025691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27200777 - 27200736
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27200777 atttttgcctggatcgccttttcgggttttcgatccaccggg 27200736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27248456 - 27248497
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27248456 atttttgcctggatcgccttttcgggttttcgatccaccggg 27248497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27355719 - 27355760
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27355719 atttttgcctggatcgccttttcgggttttcgatccaccggg 27355760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 30551674 - 30551755
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||| |||||||||    
T  30551674 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgagttttcgac 30551755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 18209466 - 18209509
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  18209466 ccctaatttttacctggatcgccctttcgggttttcgatccacc 18209509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 19717411 - 19717332
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  19717411 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 19717332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 20052568 - 20052615
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| |||||||||||||||||||||||||||||||  ||||||||||    
T  20052568 ccctaatttttgcctggatcgccctttcgggttttcagtccaccggga 20052615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 21362458 - 21362501
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  21362458 ccctaatttttacctggatcgccctttcgggttttcgatccacc 21362501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 22774807 - 22774890
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  22774807 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 22774890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 23966440 - 23966483
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  23966440 ccctaatttttacctggatcgccctttcgggttttcgatccacc 23966483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 27283970 - 27284013
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | ||||||||||||||||||||||||||||||    
T  27283970 atttttgcctgaaccgccctttcgggttttcgatccaccgggaa 27284013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4531812 - 4531734
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  4531812 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 4531734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 4539432 - 4539510
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  4539432 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 4539510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4764287 - 4764209
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4764287 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4764209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 13292623 - 13292701
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  13292623 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 13292701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 14139074 - 14139152
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  14139074 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 14139152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16680663 - 16680585
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  16680663 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 16680585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16756345 - 16756267
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16756345 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16756267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 24299434 - 24299512
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24299434 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24299512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24870229 - 24870151
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24870229 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24870151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 26110083 - 26110161
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  26110083 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 26110161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27014250 - 27014172
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  27014250 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 27014172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27025665 - 27025587
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27025665 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27025587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27209424 - 27209346
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||  |||||||||    
T  27209424 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgccctcccgggttttc 27209346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27239804 - 27239882
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||  |||||||||    
T  27239804 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgccctcccgggttttc 27239882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28213979 - 28213901
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  28213979 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 28213901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 33370105 - 33370183
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  33370105 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 33370183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 34458182 - 34458260
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  34458182 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 34458260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 617722 - 617771
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  617722 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 617771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 16584869 - 16584828
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  16584869 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 16584828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 16610511 - 16610552
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  16610511 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 16610552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 18752872 - 18752913
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||||||||||||||||||||| ||||||||||||    
T  18752872 ttttacctggatcgccctttcgggttttcaatccaccgggaa 18752913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 20042454 - 20042503
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  20042454 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 20042503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20175152 - 20175111
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||| || |||||||||||||||||||    
T  20175152 atttttgcctggatcgcccgttggggttttcgatccaccggg 20175111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22160839 - 22160880
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||| || |||||||||||||||||||    
T  22160839 atttttgcctggatcgcccgttggggttttcgatccaccggg 22160880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 27053410 - 27053451
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27053410 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27053451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 27069791 - 27069832
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27069791 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27069832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 27515958 - 27515909
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  27515958 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 27515909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 28308890 - 28308849
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  28308890 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 28308849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 206
Target Start/End: Complemental strand, 29556144 - 29556107
Alignment:
Q  169 ttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||| ||||||||||||||||||||||    
T  29556144 ttgcctggatcgccccttcgggttttcgatccaccggg 29556107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 5991853 - 5991773
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgac 246  Q
    ||||||||||| ||||| |||||||||||  |||||| ||| || || ||||| || | ||||||||||||||||||||||    
T  5991853 ttttgcctggaccgccccttcgggttttcagtccaccaggacgctcagttttggcttaagccgccctttcgggttttcgac 5991773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 20053280 - 20053344
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 229  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||    
T  20053280 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgc 20053344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 25501206 - 25501286
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt-tttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||| |||||| ||||| | ||| || |||| || || || ||||||||||||||||||||||    
T  25501206 ttttgcctggaccgccctttcgagttttcaatccatcaggacgctcattcttggcttaagccgccctttcgggttttcgac 25501286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 246
Target Start/End: Original strand, 26666333 - 26666413
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  26666333 tttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 26666413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 246
Target Start/End: Original strand, 26772304 - 26772384
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  26772304 tttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 26772384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 27515889 - 27515841
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  27515889 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 27515841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #156
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 617790 - 617837
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  617790 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 617837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 18122895 - 18122852
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||| ||||||||||||||||||||    
T  18122895 ccctaatttttacctggatcgccttttcgggttttcgatccacc 18122852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 18439299 - 18439252
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  18439299 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 18439252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 20042520 - 20042567
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  20042520 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 20042567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 21362394 - 21362433
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  21362394 ttttgcctggatcgtcctttcggattttcgatccaccggg 21362433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 23966376 - 23966415
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  23966376 ttttgcctggatcgtcctttcggattttcgatccaccggg 23966415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 24145320 - 24145367
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  24145320 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 24145367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 27515116 - 27515053
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    ||||||||||| ||||||||||||||||   ||||||| || || |||||||||||| ||||||    
T  27515116 ttttgcctggaccgccctttcgggtttttagtccaccgagacgctcatttttgcctaagccgcc 27515053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 174483 - 174433
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||| | ||||| ||||| ||||||||||||||||| ||||||||||||    
T  174483 gtccctaacttttgtctggaccgccctttcgggttttcaatccaccgggaa 174433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15406207 - 15406285
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| ||||| |||||||||    
T  15406207 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccacccttccgggttttc 15406285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15417994 - 15418072
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| ||||| |||||||||    
T  15417994 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccacccttccgggttttc 15418072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 26792340 - 26792262
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| ||||||||| |||||||||    
T  26792340 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgcccttccgggttttc 26792262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 26927276 - 26927198
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||| ||||||| | |||||||||||||||||    
T  26927276 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattcttgcctaagtcgccctttcgggttttc 26927198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27031544 - 27031466
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  27031544 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttc 27031466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 27052445 - 27052487
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  27052445 ccctaatttttacctggaccgccctttcgggttttcgatccac 27052487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27064005 - 27063927
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||| |||||| || ||||| ||||  || |||||||| ||| |||||||||||||||||||    
T  27064005 atttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgtctaagccgccctttcgggttttc 27063927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 29579538 - 29579460
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| |  ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  29579538 atttttgcctgaactgccctttcgggttgttaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 29579460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 16584787 - 16584746
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  16584787 ttttacctggaccgccctttcgggttttcaatccaccgggaa 16584746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 16610593 - 16610634
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  16610593 ttttacctggaccgccctttcgggttttcaatccaccgggaa 16610634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 16640668 - 16640583
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcg 244  Q
    |||| ||||||||||||| | |||||||||||||| ||||||||  |  || || ||||||| || ||||||| ||||||||||||    
T  16640668 ccctaatttttgcctggaccaccctttcgggtttttgatccaccaaggtgctcattttttgcttaagccgcccattcgggttttcg 16640583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 16937699 - 16937780
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||  ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  16937699 atttttgcctgaactgccctttcgggttgtcaatccggcggggtgctcattcttgcctaagccgcccttccgggttttcgac 16937780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 24145261 - 24145302
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||||||| ||||||||||||||||  |||||||||||    
T  24145261 ttttgcctggattgccctttcgggttttcagtccaccgggaa 24145302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 27070573 - 27070630
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  27070573 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 27070630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 29556082 - 29556005
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 242  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||| | |||||||||    
T  29556082 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccttctcgggtttt 29556005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 246
Target Start/End: Original strand, 23878677 - 23878756
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||||  |||||||||||||||| | |||||||  | || |||||||||||| |||||| |||| ||||| ||||    
T  23878677 tttttgcctgggccgccctttcgggttttag-tccaccgaaacgctcatttttgcctaagccgccatttcaggtttgcgac 23878756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 84
Target Start/End: Original strand, 27283969 - 27284001
Alignment:
Q  52 catttttgcatgaaccgccctttcgggttttcg 84  Q
    ||||||||| |||||||||||||||||||||||    
T  27283969 catttttgcctgaaccgccctttcgggttttcg 27284001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 167)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 307
Target Start/End: Original strand, 2104360 - 2104655
Alignment:
Q  12 tgatgtgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 111  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  2104360 tgatttgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgcttattcttgcctg 2104459  T
Q  112 agttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 211  Q
    ||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  2104460 agttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcgggttttcgatccaccggaaagcg 2104559  T
Q  212 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  2104560 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 2104655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 5141540 - 5141832
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  5141540 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 5141639  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng---gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcat 214  Q
    ||||||||||||||||||||||||||||||             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  5141640 gtacaatctcagcgagctttttcatatttgtttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcat 5141739  T
Q  215 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5141740 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5141832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 26664121 - 26664406
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  26664121 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 26664220  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  26664221 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 26664319  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  26664320 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 26664406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 26679313 - 26679598
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  26679313 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 26679412  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  26679413 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 26679511  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  26679512 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 26679598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 24586740 - 24587026
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  24586740 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 24586839  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24586840 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24586936  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||    
T  24586937 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcggcattcac 24587026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 2779184 - 2778900
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  2779184 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 2779085  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  2779084 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 2778990  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||    
T  2778989 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcagcattcac 2778900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 16047247 - 16046960
Alignment:
Q  19 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 118  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16047247 ccagatatagttacttgccttt-gtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 16047149  T
Q  119 tacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    |||||||||||||||||||| ||||||||          ||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||    
T  16047148 tacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctagaccgccctttcgggttttcgatccaccgggaagcggattttt 16047052  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
T  16047051 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttctttactatatcagcattcacagg 16046960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 26269296 - 26269578
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  26269296 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 26269395  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  26269396 acaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 26269490  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26269491 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26269578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4205321 - 4205035
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||     
T  4205321 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcggctcatcgagacgctcattcttgcctgagttgt 4205222  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4205221 gttcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 4205125  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||    
T  4205124 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcggcattcac 4205035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5164316 - 5164029
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  5164316 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 5164217  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    |||||||||||||| |||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5164216 gtacaatctcagcgcgctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5164119  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5164118 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5164029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31558598 - 31558882
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  31558598 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31558697  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
T  31558698 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgaatttt 31558792  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31558793 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31558882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 45393150 - 45392866
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  45393150 gccagatatagttacttgccctttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 45393051  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  45393050 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 45392956  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  45392955 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 45392866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 16512639 - 16512925
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16512639 gccagatatagttacttgcctctcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 16512738  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||    
T  16512739 gtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgcccttttgggttttcgatccaccgggaagcgcatttt 16512832  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  16512833 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcacagg 16512925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 26532075 - 26532365
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26532075 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcggattttcggctcatcgagacgctcattcttgcctgagttgc 26532174  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||||||||||||||||||||| ||||| ||            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  26532175 gtacaatctcagcgagctttt-catatgtgtgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 26532273  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26532274 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26532365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 16444208 - 16444501
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  16444208 gccagatatagttacttgccttttgtttcaatctcattttcgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 16444307  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
     |||||||||||||||||||||||||||||            ||||||||||||| |||||| |||||||| ||||||| ||||||||||||||||||||    
T  16444308 atacaatctcagcgagctttttcatatttgtttttgttttttgtcccttattttt-cctggaccgcccttttgggtttttgatccaccgggaagcgcatt 16444406  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  16444407 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 16444501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 26314056 - 26314340
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  26314056 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 26314155  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||         | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  26314156 caatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 26314253  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  26314254 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 26314340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 11446820 - 11446533
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  11446820 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 11446721  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||| ||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  11446720 gtataatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11446623  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  11446622 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 11446533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 16732735 - 16733018
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16732735 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 16732834  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16732835 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16732928  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  16732929 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 16733018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 16745726 - 16746009
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16745726 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 16745825  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16745826 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16745919  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  16745920 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 16746009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 26441185 - 26440903
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  26441185 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 26441086  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26441085 gtacaatctcagcgagctttt-catatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26440993  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  26440992 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 26440903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 39207346 - 39207631
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||    
T  39207346 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcattgagacgctcattcttgcctgagttgtgt 39207445  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  39207446 acaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 39207543  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  39207544 cctagtccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 39207631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 4139452 - 4139738
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||     
T  4139452 gccaggtatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcgattcatcgagacgctcattcttgcctgagttgt 4139551  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||| ||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4139552 gtataatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 4139648  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4139649 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4139738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5154016 - 5153730
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
T  5154016 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcaagacgctcattcttgcctgagttgc 5153917  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || ||| |||||||||||||||||||| |           |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||    
T  5153916 gtgcaacctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccaccctttcgggttttcgatccaccgggaagcgcatttt 5153820  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5153819 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5153730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 26518725 - 26518438
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  26518725 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 26518626  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||| ||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26518625 gtataatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26518528  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  26518527 tgcctaggccgccctttcgggttttcgacctaccacactgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 26518438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31084828 - 31085114
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  31084828 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 31084927  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||    
T  31084928 gtgcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaggcgcatttt 31085024  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31085025 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31085114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 31129837 - 31129553
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  31129837 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31129738  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||    
T  31129737 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggtttaccatccaccgggaagcgcatttt 31129643  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  31129642 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 31129553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 26509902 - 26510188
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  26509902 gccagatatagttacttgcctttcgtttcaatctcgtttttgcatgaaccgccctttcgggttttcggttcatcgagacgctcattcttgcctgagttgc 26510001  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  26510002 gtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 26510098  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| |||||||||||||||||||| ||||||||    
T  26510099 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttctcatttatttaggcaaagtatttcttgactatatcggcattcac 26510188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 11418984 - 11419271
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||  |||||||||||||||||||||||||||||||    
T  11418984 gccagatatagttacttgccttttgtttcaatctcttttttgcatgaaccgcccttccgggctttcgattcatcgagacgctcattcttgcctgagttgc 11419083  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  11419084 gtgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11419181  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||| ||||||||    
T  11419182 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaaatatttcttgactatatcggcattcac 11419271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 45737235 - 45736953
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  45737235 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 45737136  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  45737135 gtacaatctcagcgagctttt-catatattttttt-----gtcccttacttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 45737043  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  45737042 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 45736953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 2160500 - 2160220
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||  ||||||||||||||||||||||||||||| |||    
T  2160500 agatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggtccatcgagacgctcattcttgcctgagttgtgta 2160401  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||    
T  2160400 caatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcaggttttcgatccaccgggaagcgtatttttgc 2160307  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  2160306 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 2160220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 22 - 307
Target Start/End: Complemental strand, 3451246 - 3450952
Alignment:
Q  22 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtac 121  Q
    ||||||||||||||||||||||||||| ||| |||||||||||||| ||||| ||||||||||  |||||||||||||||||||||||||||||| |||     
T  3451246 gatatagttacttgccttttgtttcaacctcctttttgcatgaaccacccttccgggttttcgattcatcgagacgctcattcttgcctgagttgtgtat 3451147  T
Q  122 aatctcagcgagctttttcatatttgnnnnnnnnng----------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 211  Q
    ||||||||||||||||| ||||||||                    |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  3451146 aatctcagcgagctttt-catatttgttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcg 3451048  T
Q  212 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3451047 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3450952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 114 - 310
Target Start/End: Complemental strand, 10847453 - 10847263
Alignment:
Q  114 ttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca 213  Q
    ||||||||||||||||||||||||||||||||||          |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
T  10847453 ttgcgtacaatctcagcgagctttttcatatttgttttt-----gtcccttatttt-gcctggatcgccctttcgagttttcgatccaccgggaagcgca 10847360  T
Q  214 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  10847359 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 10847263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 10911125 - 10911299
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||  |||||||||||||||||||||||||||||     
T  10911125 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggtccatcgagacgctcattcttgcctgagttgt 10911224  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcga 197  Q
    ||||||||||||||||| |||||||||||           |||||||||||||||||||| |||||||||||||||||||    
T  10911225 gtacaatctcagcgagc-ttttcatattt----tttttttgtcccttatttttgcctggaccgccctttcgggttttcga 10911299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 213 - 307
Target Start/End: Original strand, 10911267 - 10911361
Alignment:
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10911267 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10911361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 15195847 - 15195702
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||| ||||||||||    
T  15195847 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccaagctgttcttt 15195748  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  15195747 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 15195702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 2559299 - 2559154
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  2559299 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 2559200  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  2559199 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 2559154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 29092280 - 29092135
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| ||||||||||||||||||||||| || || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  29092280 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 29092181  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  29092180 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 29092135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 16125215 - 16125360
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  16125215 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 16125314  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | || ||||||||||||  ||| | |||||||||    
T  16125315 t-atatatttagacaaaatatttcttgactgcatccgaattcacagg 16125360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 16240180 - 16240035
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| ||||||||||||||||||||||| || || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  16240180 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 16240081  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||  | |||||||||||||||  ||||| |||||||||    
T  16240080 t-atatatttaaacaaagtatttcttgactgcatcagaattcacagg 16240035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 1890947 - 1891094
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||||||||||| |||||||  ||||||||||    
T  1890947 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 1891046  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  1891047 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 1891094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Complemental strand, 9472080 - 9471981
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  9472080 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 9471981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 1890265 - 1890341
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  1890265 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 1890341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 27971365 - 27971452
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27971365 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 27971452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 16267904 - 16267990
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| |||||| |||| ||||| ||||    
T  16267904 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggtttgcgac 16267990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 5204232 - 5204319
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  5204232 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 5204319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 13836786 - 13836699
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  13836786 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 13836699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 251
Target Start/End: Original strand, 16390806 - 16390893
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctacc 251  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||    
T  16390806 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttacc 16390893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 3451843 - 3451765
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||||||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  3451843 atttttgcctggatcgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgcccttccgggttttc 3451765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 11418392 - 11418470
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11418392 atttttgcctggactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11418470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 293
Target Start/End: Original strand, 30367318 - 30367448
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  30367318 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 30367417  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    || | |  | ||| | |||||||||||||||    
T  30367418 ttaaaaattttagacaaagtatttcttgact 30367448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 39206753 - 39206831
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  39206753 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 39206831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2161162 - 2161121
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2161162 atttttgcctggatcgccctttcgggttttcgatccaccggg 2161121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2779836 - 2779795
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2779836 atttttgcctggatcgccctttcgggttttcgatccaccggg 2779795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5154673 - 5154632
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5154673 atttttgcctggatcgccctttcgggttttcgatccaccggg 5154632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5164975 - 5164934
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5164975 atttttgcctggatcgccctttcgggttttcgatccaccggg 5164934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 10848175 - 10848134
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10848175 atttttgcctggatcgccctttcgggttttcgatccaccggg 10848134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 10910473 - 10910514
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10910473 atttttgcctggatcgccctttcgggttttcgatccaccggg 10910514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 11418326 - 11418367
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11418326 atttttgcctggatcgccctttcgggttttcgatccaccggg 11418367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16511987 - 16512028
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16511987 atttttgcctggatcgccctttcgggttttcgatccaccggg 16512028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 24586082 - 24586123
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24586082 atttttgcctggatcgccctttcgggttttcgatccaccggg 24586123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 24586148 - 24586229
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  24586148 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 24586229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26268632 - 26268673
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26268632 atttttgcctggatcgccctttcgggttttcgatccaccggg 26268673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26441841 - 26441800
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26441841 atttttgcctggatcgccctttcgggttttcgatccaccggg 26441800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26596260 - 26596219
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26596260 atttttgcctggatcgccctttcgggttttcgatccaccggg 26596219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26663459 - 26663500
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26663459 atttttgcctggatcgccctttcgggttttcgatccaccggg 26663500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26678651 - 26678692
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26678651 atttttgcctggatcgccctttcgggttttcgatccaccggg 26678692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31557941 - 31557982
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31557941 atttttgcctggatcgccctttcgggttttcgatccaccggg 31557982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 39206687 - 39206728
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  39206687 atttttgcctggatcgccctttcgggttttcgatccaccggg 39206728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 4138793 - 4138833
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  4138793 tttttgcctggatcgccctttcgggttttcgatccaccggg 4138833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 310
Target Start/End: Original strand, 13482633 - 13482724
Alignment:
Q  222 taggccgccctttcgggttttcgacctaccacgctgttctttt-ca--tatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| ||  ||||||||| | |||||||||||||||  ||||| |||||||||    
T  13482633 taggccgccctttcgggttttcgccctaccgagctgttcttttacatgtatatctagacaaagtatttcttgactgcatcagaattcacagg 13482724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 564273 - 564360
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || ||  |||||||||||||||||||||    
T  564273 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaaaccgccctttcgggttttcgac 564360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 27439654 - 27439567
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||| ||||| || ||||||| || ||  |||||||||||||||||||||    
T  27439654 ccctaatttttgcctggaccgccctttcgggttttcagtccatcgggacgctcatttttggcttaaaccgccctttcgggttttcgac 27439567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 43 - 81
Target Start/End: Complemental strand, 10847490 - 10847452
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttt 81  Q
    |||||||||||||||||||||||||||||||||||||||    
T  10847490 tttcaatctcatttttgcatgaaccgccctttcgggttt 10847452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 16745133 - 16745211
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| | |||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16745133 atttttgcctgaaccgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16745211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 22148479 - 22148441
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22148479 atttttgcctggatcgccctttcgggttttcgatccacc 22148441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 22152706 - 22152668
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22152706 atttttgcctggatcgccctttcgggttttcgatccacc 22152668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 22208621 - 22208583
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22208621 atttttgcctggatcgccctttcgggttttcgatccacc 22208583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 26519315 - 26519237
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  26519315 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 26519237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 31130423 - 31130345
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31130423 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31130345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 31558007 - 31558085
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31558007 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31558085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 45737827 - 45737749
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  45737827 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 45737749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5140881 - 5140922
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||| |||||||||||||||||||||||||||||    
T  5140881 atttttgcctggctcgccctttcgggttttcgatccaccggg 5140922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 11447478 - 11447437
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||| |||||||||||||||||||||||||    
T  11447478 atttttgcctggatcgtcctttcgggttttcgatccaccggg 11447437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 12589388 - 12589347
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  12589388 ttttgcctggatcgccctttcgggttttcaatccaccgggaa 12589347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 16047903 - 16047866
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccac 202  Q
    ||||||||||||||||||||||||||||||||||||||    
T  16047903 atttttgcctggatcgccctttcgggttttcgatccac 16047866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 16268608 - 16268689
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  16268608 atttctgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 16268689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16443550 - 16443591
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||| ||||||||||||||||||||||||||||    
T  16443550 atttttgcctggaccgccctttcgggttttcgatccaccggg 16443591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26313396 - 26313437
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||| |||||||||||||||||||||||||    
T  26313396 atttttgcctggatcgtcctttcgggttttcgatccaccggg 26313437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26519381 - 26519340
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  26519381 atttttgcctggatcgccctttcgggttttcgatccatcggg 26519340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 31084235 - 31084316
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  31084235 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 31084316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31130489 - 31130448
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  31130489 atttttgcctggatcgccttttcgggttttcgatccaccggg 31130448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 45393809 - 45393768
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  45393809 atttttgcctggatcgccctttcgggttttcgatccatcggg 45393768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 45737893 - 45737852
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  45737893 atttttgcctggatcgccctttcgggttttcgacccaccggg 45737852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 795912 - 795996
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  795912 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 795996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 4205979 - 4205939
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
    ||||||||||||||||||||||||||||||| |||||||||    
T  4205979 atttttgcctggatcgccctttcgggttttcaatccaccgg 4205939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 16284768 - 16284852
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  16284768 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 16284852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 246
Target Start/End: Original strand, 1956304 - 1956371
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||| |||||||  |||||||||| || |||||||||||| |||||| |||| ||||||||||    
T  1956304 cgccctttcaggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggttttcgac 1956371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 9472732 - 9472649
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || | || ||||||| | |||| |||| |||||||    
T  9472732 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctctttgttgcctaagtcgccttttcaggttttc 9472649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 11447397 - 11447334
Alignment:
Q  180 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11447397 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11447334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 16124570 - 16124613
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  16124570 ccctaatttttacctggatcgccctttcgggttttcgatccacc 16124613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 26509242 - 26509285
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | ||||||||||||||||||||||||||||||    
T  26509242 atttttgcctgaaccgccctttcgggttttcgatccaccgggaa 26509285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 29092932 - 29092889
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  29092932 ccctaatttttacctggatcgccctttcgggttttcgatccacc 29092889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 34135471 - 34135550
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  34135471 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 34135550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 38409123 - 38409036
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||||||||| |||||||  |||| | ||| || ||||||| || || ||||||||||||||||||||||    
T  38409123 ccctaatttttgcctggaccgccctttcaggttttcactccatcaggacgctcatttttggcttaagccgccctttcgggttttcgac 38409036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 246
Target Start/End: Original strand, 3426982 - 3427064
Alignment:
Q  164 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||||||| |||||||||||||||||   |||||  || || |||||||||||| |||||| |||| ||||| ||||    
T  3426982 tatttttgcctggaccgccctttcgggttttcagaccaccaagacgctcatttttgcctaagccgccttttcaggtttgcgac 3427064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4205913 - 4205835
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||| | || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4205913 atttttgcctgaactgccctttcggggtgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4205835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 5140947 - 5141025
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  5140947 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 5141025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5154607 - 5154529
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5154607 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5154529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 10848109 - 10848031
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||| || | |||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  10848109 atttttgcgtgaaccgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 10848031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 10910539 - 10910617
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  10910539 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 10910617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 13836861 - 13836811
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  13836861 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 13836811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 26268698 - 26268776
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26268698 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26268776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 26313462 - 26313540
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26313462 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26313540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 26663525 - 26663603
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  26663525 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 26663603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 26678717 - 26678795
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  26678717 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 26678795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 45393743 - 45393665
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  45393743 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 45393665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 564209 - 564250
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  564209 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 564250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 795898 - 795955
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| ||| |||||||||||||||||| || || ||||||||||||| ||||||    
T  795898 atttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatttttgcct 795955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 4942935 - 4942976
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||||||||||| ||||    
T  4942935 ttttgcctggaccgccctttcgggttttcgatccaccaggaa 4942976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 5204168 - 5204209
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  5204168 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 5204209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 8816139 - 8816090
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  8816139 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 8816090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9472796 - 9472747
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  9472796 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 9472747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 16284754 - 16284811
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| ||| |||||||||||||||||| || || ||||||||||||| ||||||    
T  16284754 atttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatttttgcct 16284811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16390073 - 16390122
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  16390073 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 16390122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 16482197 - 16482238
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||| ||||||||||||||| ||||||||||||    
T  16482197 ttttgcctggatctccctttcgggttttcaatccaccgggaa 16482238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 23881145 - 23881194
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  23881145 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 23881194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 27971301 - 27971342
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27971301 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27971342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 29027802 - 29027761
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||||||||||||| ||||||||||||    
T  29027802 ttttgtctggatcgccctttcgggttttcaatccaccgggaa 29027761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31084169 - 31084210
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  31084169 atttttgcttggatcgccctttcgggttttcgacccaccggg 31084210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 38409187 - 38409146
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  38409187 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 38409146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 42632819 - 42632868
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  42632819 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 42632868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 30366618 - 30366666
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  30366618 tccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 30366666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 563195 - 563234
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||| |||| |||||||||||    
T  563195 ttttgcctggatcgccctttcggattttggatccaccggg 563234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 844228 - 844181
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  844228 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 844181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 851404 - 851357
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  851404 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 851357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 1209408 - 1209361
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  1209408 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 1209361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 3426271 - 3426318
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  3426271 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 3426318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 4942998 - 4943085
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||  ||| ||||||||| || ||||||||||| || | ||||| || || |||||||||| |||||||||||    
T  4942998 ccctaatttttgcctggactgccttttcgggttctcaatccaccgggacgctcgtttttggcttaagccgccctttagggttttcgac 4943085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 8816075 - 8816028
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  8816075 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 8816028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 16240885 - 16240846
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  16240885 ttttgcctggatcgtcctttcggattttcgatccaccggg 16240846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 16390140 - 16390187
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  16390140 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 16390187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 243
Target Start/End: Original strand, 16443631 - 16443694
Alignment:
Q  180 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  16443631 gccctttcgggttatcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 16443694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 22152620 - 22152561
Alignment:
Q  184 tttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22152620 tttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22152561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 22208535 - 22208476
Alignment:
Q  184 tttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22208535 tttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22208476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 42632885 - 42632932
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  42632885 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 42632932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 2161096 - 2161018
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  2161096 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 2161018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 2559949 - 2559903
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||| |||||| |||||||||| ||||||||||||| ||||||||||    
T  2559949 ccctaatttttacctggatcgcactttcgggttttcaatccaccggg 2559903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 2779770 - 2779692
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |   ||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  2779770 atttttgcctgaacttccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 2779692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 4138858 - 4138936
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||| | | |||||||||||||||||    
T  4138858 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcccaagtcgccctttcgggttttc 4138936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5164908 - 5164830
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||| ||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5164908 atttttgcctgaactgccttttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5164830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 219
Target Start/End: Complemental strand, 12588611 - 12588557
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||    
T  12588611 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttg 12588557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16047837 - 16047759
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |  ||||||||||||||||    
T  16047837 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagttgccctttcgggttttc 16047759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 16240180 - 16240130
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| || ||||||||||||||||||||   ||||||||||||||||    
T  16240180 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatt 16240130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 16240814 - 16240772
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  16240814 ccctaatttttacctggatcaccctttcgggttttcgatccac 16240772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 16267844 - 16267882
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
    |||||||| |||||||||||||||||||| |||||||||    
T  16267844 ttttgcctagatcgccctttcgggttttcaatccaccgg 16267882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 16512053 - 16512131
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||| |||| ||||||||| |||||||||    
T  16512053 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattttttcctaagccgcccttccgggttttc 16512131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 206
Target Start/End: Original strand, 16745070 - 16745108
Alignment:
Q  169 ttgcctggatcgcccttt-cgggttttcgatccaccggg 206  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  16745070 ttgcctggatcgcccttttcgggttttcgatccaccggg 16745108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 26596194 - 26596116
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||| ||| ||||||||| |||||||||    
T  26596194 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgtctaagccgcccttccgggttttc 26596116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 29092280 - 29092230
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| || ||||||||||||||||||||   ||||||||||||||||    
T  29092280 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatt 29092230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 563260 - 563297
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  563260 tttttgcctggaccgccctttcgggtttttgatccacc 563297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 565046 - 565091
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  565046 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 565091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 9472080 - 9472023
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  9472080 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 9472023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 16390806 - 16390863
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  16390806 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 16390863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27970372 - 27970413
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||| |||||||| |||| |||||||||||    
T  27970372 atttttgcctggatcgtcctttcggattttggatccaccggg 27970413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 29027738 - 29027650
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct--aggccgccctttcgggttttcgac 246  Q
    |||| |||||||| |||| || ||||||||||||||  |||| ||||| || |||||||| ||  |  |||||||||||||||||||||    
T  29027738 ccctaatttttgcttggaccgtcctttcgggttttcagtccatcgggacgctcatttttggcttaaaaccgccctttcgggttttcgac 29027650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 23881217 - 23881257
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  23881217 ttttgcctggaccgccctttcgggttttcagtccaccggga 23881257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 84
Target Start/End: Original strand, 26509241 - 26509273
Alignment:
Q  52 catttttgcatgaaccgccctttcgggttttcg 84  Q
    ||||||||| |||||||||||||||||||||||    
T  26509241 catttttgcctgaaccgccctttcgggttttcg 26509273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 219)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 43084198 - 43083911
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  43084198 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 43084099  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  43084098 acaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 43083999  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  43083998 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 43083911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13181008 - 13181297
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  13181008 gccagatatagttacttgcctttggtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 13181107  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  13181108 gtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcgggttttcgatccatcgggaagcgcatttt 13181207  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||    
T  13181208 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgaccatatcagcattcac 13181297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 30157972 - 30157687
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  30157972 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 30157873  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  30157872 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 30157774  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  30157773 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 30157687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 9544927 - 9545213
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  9544927 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 9545026  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9545027 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 9545123  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  9545124 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 9545213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13436900 - 13437187
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  13436900 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 13436999  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  13437000 gtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 13437097  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  13437098 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 13437187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 23897817 - 23897528
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23897817 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 23897718  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggtttt-cgatccaccgggaagcgcattt 216  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||    
T  23897717 gtacaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggtttttcgatccaccgggaagcgcattt 23897622  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  23897621 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcacagg 23897528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 31437406 - 31437120
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  31437406 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 31437307  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31437306 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31437210  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31437209 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31437120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37746546 - 37746833
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  37746546 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 37746645  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
T  37746646 gtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatttt 37746743  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37746744 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37746833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 40467772 - 40468054
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  40467772 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 40467871  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || ||||||||||||||||||||||||||           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  40467872 gtgcaatctcagcgagctttttcatattttttt-------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 40467964  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  40467965 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 40468054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 6880245 - 6879961
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  6880245 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 6880146  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  6880145 gtacaatctcagcgagctttt-catatttgtttctt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 6880051  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||| ||||||||    
T  6880050 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgattatatcggcattcac 6879961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13319046 - 13319334
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  13319046 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 13319145  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||  |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  13319146 gtacaatctcagcgagctttttcatacatatttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 13319244  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  13319245 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 13319334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 23631911 - 23631625
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  23631911 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 23631812  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  23631811 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 23631715  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  23631714 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 23631625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 24729912 - 24729625
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  24729912 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 24729813  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24729812 ttacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24729715  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  24729714 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 24729625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 34622460 - 34622174
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  34622460 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 34622361  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  34622360 gtacaatctcagcgagctttt-catatttgttttttgt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 34622264  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  34622263 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 34622174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 15652977 - 15653261
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  15652977 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 15653076  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  15653077 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 15653171  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  15653172 tgcccaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 15653261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18369751 - 18370038
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  18369751 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 18369850  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||| ||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18369851 atacaatctcagcgagctttt-catttttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18369948  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18369949 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18370038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 32590494 - 32590778
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  32590494 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 32590593  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| |||||||           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  32590594 gttcaatctcagcgagctttt-catatttatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 32590688  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  32590689 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 32590778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 33881069 - 33880784
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||| |||||||||||||    
T  33881069 gccagatatagttacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcatttttgcctgagttgc 33880970  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    | ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  33880969 gaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 33880874  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  33880873 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 33880784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37352863 - 37353147
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  37352863 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 37352962  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  37352963 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 37353057  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  37353058 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 37353147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18494986 - 18495276
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  18494986 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 18495085  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  18495086 gtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 18495184  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18495185 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18495276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 24975791 - 24975504
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  24975791 gccagatatagttacttgcctctcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 24975692  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24975691 gtacaatctcagcgagctttttcatatatatatttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24975593  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattca 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
T  24975592 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattca 24975504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 25270376 - 25270086
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
T  25270376 gccagatatagttacttgccttt-gtttcaatctcatttttgcataaacctcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 25270278  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  25270277 gtacaatctcagcgagctttttcatatttgttttttttttgtcccttgtttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 25270178  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
T  25270177 -gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttgactatatcagcattcacagg 25270086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 33783429 - 33783141
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  33783429 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 33783330  T
Q  118 gt--acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||  ||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  33783329 gtgtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 33783233  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  33783232 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 33783141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 3795480 - 3795197
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  3795480 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 3795381  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  3795380 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 3795287  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3795286 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3795197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 15753070 - 15753356
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||    
T  15753070 gccagatatagttacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgatttgc 15753169  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  15753170 gtacaatctcagcgagctttt-catgtttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 15753266  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  15753267 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 15753356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 30035369 - 30035084
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||| |||||||||||||    
T  30035369 gccagatatagttacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcatttttgcctgagttgc 30035270  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    | ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  30035269 gaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 30035174  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  30035173 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 30035084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31820627 - 31820911
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  31820627 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31820726  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31820727 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31820821  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||| |||||||||||||||||||| ||||||||    
T  31820822 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatattcttaggcaaagtatttcttgactatatcggcattcac 31820911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37665705 - 37665990
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  37665705 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 37665804  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||  |||||||||||||||||||    
T  37665805 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcggcccaccgggaagcgcatttt 37665900  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37665901 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37665990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 24608188 - 24607910
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  24608188 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 24608089  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24608088 ttacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24607991  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatc 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||    
T  24607990 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatc 24607910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 25206220 - 25205931
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
T  25206220 gccagatatagttacttgccttt-gtttcaatctcatttttgcataaacctcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 25206122  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||         | |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  25206121 gtacaatctcagcgagctttttcatatttgtttttttttg-tcccttgtttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 25206023  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
T  25206022 -gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttgactatatcagcattcacagg 25205931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 11329577 - 11329293
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  11329577 cagatatagttacttgccttttgtttcaatctcatttttgcatgaactgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 11329478  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
     ||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  11329477 gcaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 11329381  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  11329380 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 11329293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 22894359 - 22894064
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22894359 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaactgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 22894260  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng----gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca 213  Q
    ||||||||||||||||||||| ||||||||              |||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||    
T  22894259 gtacaatctcagcgagctttt-catatttgttttttttttttttgtcccttatttttgcctggaccgccctttcgggtttttgatccaccgcgaagcgca 22894161  T
Q  214 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  22894160 tttttgcctaggtcgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 22894064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 26486335 - 26486050
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  26486335 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 26486236  T
Q  121 caatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  26486235 caatctcagcgagcttttttcatatatatatttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 26486138  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  26486137 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 26486050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 2517007 - 2516718
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  2517007 gccagatatagttacttgcctttggtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 2516908  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||| ||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  2516907 gtataatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 2516809  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  2516808 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 2516718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 8659690 - 8659979
Alignment:
Q  18 gccagatatagttacttgcctt-ttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttg 116  Q
    |||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  8659690 gccagatatagttacttgccctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttg 8659789  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    || |||| |||||||||||||||||||||||         | ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
T  8659790 cgaacaacctcagcgagctttttcatatttgtttttttgtg-tcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcattt 8659888  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  8659889 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 8659979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 9323416 - 9323132
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  9323416 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 9323317  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||         | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||    
T  9323316 caatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattcttgc 9323219  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  9323218 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 9323132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 12138115 - 12137831
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  12138115 agatatagttacttgtcttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 12138016  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||         | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  12138015 caatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 12137918  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  12137917 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 12137831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 30174404 - 30174125
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  30174404 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 30174305  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  30174304 caatctcagcgagctttt-catatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 30174212  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  30174211 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 30174125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 11555296 - 11555011
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  11555296 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 11555197  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  11555196 gtacaatctcagcgagctttttcatatattttttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11555101  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  11555100 tacctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 11555011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28655184 - 28654899
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  28655184 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 28655085  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28655084 gttcaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28654989  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28654988 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28654899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 30940578 - 30940291
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||     
T  30940578 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccttttcgggttttcggctcatcgagacgctcattcctgcctgagttgt 30940479  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  30940478 gtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 30940381  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  30940380 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 30940291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 33522321 - 33522036
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  33522321 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 33522222  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  33522221 ttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 33522126  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  33522125 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 33522036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 37760924 - 37760639
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  37760924 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 37760825  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  37760824 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 37760729  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37760728 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37760639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 307
Target Start/End: Original strand, 28954003 - 28954289
Alignment:
Q  22 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtac 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||    
T  28954003 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggtcttcggctcatcgagacgctcattcttgcctgagttgcgtac 28954102  T
Q  122 aatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  28954103 aatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 28954201  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  28954202 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 28954289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 33298475 - 33298186
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||     
T  33298475 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcgattcatcgagacgctcattcttgcctgagttgt 33298376  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng---gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcat 214  Q
    ||||||||||||||||||||| ||||||||             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  33298375 gtacaatctcagcgagctttt-catatttgtttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcat 33298277  T
Q  215 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattc 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||    
T  33298276 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattc 33298186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18122635 - 18122920
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  18122635 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 18122734  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18122735 atgcaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18122830  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||| ||||||||    
T  18122831 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactacatcggcattcac 18122920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 22993335 - 22993621
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  22993335 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 22993434  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    |||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  22993435 gtacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 22993531  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  22993532 tgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 22993621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 41680646 - 41680361
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  41680646 gccagatatagttacttgccttttgtttcaatctcatttttgcataaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 41680547  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  41680546 gtgcaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 41680451  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  41680450 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 41680361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5643744 - 5643444
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  5643744 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 5643645  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng------------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
    ||||||||||||||||||||| ||||||||                      |||||||||||||||||||| |||||||||||||||||||||||||||    
T  5643644 gtacaatctcagcgagctttt-catatttgttttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgg 5643546  T
Q  206 gaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattc 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||    
T  5643545 gaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcggcattc 5643446  T
Q  306 ac 307  Q
    ||    
T  5643445 ac 5643444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 181 - 310
Target Start/End: Original strand, 29885575 - 29885704
Alignment:
Q  181 ccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaa 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
T  29885575 ccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgttgttcctttcatatatctaggcgaa 29885674  T
Q  281 gtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||  ||||||||||    
T  29885675 gtatttcttgactatatcgacattcacagg 29885704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 3481589 - 3481734
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  3481589 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 3481688  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  3481689 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 3481734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 20375015 - 20375162
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  20375015 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 20375114  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  20375115 tatacatatttagacaaagtatttcttgactgcatcagaattcacagg 20375162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 5437611 - 5437710
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  5437611 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 5437710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 11941808 - 11941907
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  11941808 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 11941907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 245
Target Start/End: Original strand, 21862452 - 21862538
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcga 245  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || ||||||| || || |||||||||||||||||||||    
T  21862452 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttggcttaagccgccctttcgggttttcga 21862538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 21990740 - 21990827
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  21990740 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 21990827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 27228714 - 27228801
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27228714 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcactttttgcttaagccgccctttcgggttttcgac 27228801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 165 - 293
Target Start/End: Original strand, 15782109 - 15782239
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||||||| |||||||||||| ||||  |||||||||    
T  15782109 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 15782208  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    || | || | ||| | |||||||||||||||    
T  15782209 ttaaaatttttagacaaagtatttcttgact 15782239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 293
Target Start/End: Complemental strand, 31523082 - 31522953
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc-ctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||  ||||||||||||||| ||||  ||||||||||    
T  31523082 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcctttttcgggttttcgacttaccgagctgttcttt 31522983  T
Q  264 tcatatatctaggcgaagtatttcttgact 293  Q
    | |  | | ||| | |||||||||||||||    
T  31522982 taaagtttttagacaaagtatttcttgact 31522953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 12175675 - 12175755
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  12175675 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 12175755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 311
Target Start/End: Complemental strand, 17959873 - 17959725
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  17959873 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 17959774  T
Q  263 ttcatatatctaggcgaagtatttcttgactatatcagcattcacaggt 311  Q
    || |  | | ||| | ||||||||||||||| |||| |  |||||||||    
T  17959773 ttaaagtttttagacaaagtatttcttgactgtatccgtgttcacaggt 17959725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 11808515 - 11808602
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  11808515 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 11808602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 26084454 - 26084541
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  26084454 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 26084541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 28849287 - 28849200
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  28849287 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 28849200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 29899159 - 29899076
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  29899159 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 29899076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 36373346 - 36373445
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  ||||||||||    
T  36373346 attttttcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttcttt 36373445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 36998000 - 36998099
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  ||||||||||    
T  36998000 attttttcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttcttt 36998099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2517666 - 2517625
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2517666 atttttgcctggatcgccctttcgggttttcgatccaccggg 2517625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 6880904 - 6880863
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6880904 atttttgcctggatcgccctttcgggttttcgatccaccggg 6880863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 9324076 - 9324035
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9324076 atttttgcctggatcgccctttcgggttttcgatccaccggg 9324035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 9544268 - 9544309
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9544268 atttttgcctggatcgccctttcgggttttcgatccaccggg 9544309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 11555953 - 11555912
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11555953 atttttgcctggatcgccctttcgggttttcgatccaccggg 11555912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12138775 - 12138734
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12138775 atttttgcctggatcgccctttcgggttttcgatccaccggg 12138734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 13180354 - 13180395
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  13180354 atttttgcctggatcgccctttcgggttttcgatccaccggg 13180395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 13318389 - 13318430
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  13318389 atttttgcctggatcgccctttcgggttttcgatccaccggg 13318430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15652322 - 15652363
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15652322 atttttgcctggatcgccctttcgggttttcgatccaccggg 15652363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18369093 - 18369134
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18369093 atttttgcctggatcgccctttcgggttttcgatccaccggg 18369134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18494329 - 18494370
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18494329 atttttgcctggatcgccctttcgggttttcgatccaccggg 18494370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22992685 - 22992726
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22992685 atttttgcctggatcgccctttcgggttttcgatccaccggg 22992726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 23632571 - 23632530
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23632571 atttttgcctggatcgccctttcgggttttcgatccaccggg 23632530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 23726835 - 23726794
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23726835 atttttgcctggatcgccctttcgggttttcgatccaccggg 23726794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24730570 - 24730529
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24730570 atttttgcctggatcgccctttcgggttttcgatccaccggg 24730529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24976443 - 24976402
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24976443 atttttgcctggatcgccctttcgggttttcgatccaccggg 24976402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 25206884 - 25206843
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  25206884 atttttgcctggatcgccctttcgggttttcgatccaccggg 25206843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 25271040 - 25270999
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  25271040 atttttgcctggatcgccctttcgggttttcgatccaccggg 25270999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 26486985 - 26486944
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26486985 atttttgcctggatcgccctttcgggttttcgatccaccggg 26486944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 28953339 - 28953380
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28953339 atttttgcctggatcgccctttcgggttttcgatccaccggg 28953380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 30175066 - 30175025
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30175066 atttttgcctggatcgccctttcgggttttcgatccaccggg 30175025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 30941231 - 30941190
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30941231 atttttgcctggatcgccctttcgggttttcgatccaccggg 30941190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31438057 - 31438016
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31438057 atttttgcctggatcgccctttcgggttttcgatccaccggg 31438016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33299137 - 33299096
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33299137 atttttgcctggatcgccctttcgggttttcgatccaccggg 33299096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 33522917 - 33522836
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  33522917 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 33522836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37352205 - 37352246
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  37352205 atttttgcctggatcgccctttcgggttttcgatccaccggg 37352246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 40467112 - 40467153
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40467112 atttttgcctggatcgccctttcgggttttcgatccaccggg 40467153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 41681305 - 41681264
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41681305 atttttgcctggatcgccctttcgggttttcgatccaccggg 41681264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 43084857 - 43084816
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  43084857 atttttgcctggatcgccctttcgggttttcgatccaccggg 43084816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 20382474 - 20382387
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  20382474 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 20382387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 21692730 - 21692651
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  21692730 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 21692651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 23898467 - 23898428
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  23898467 ttttgcctggatcgccctttcgggttttcgatccaccggg 23898428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 33839997 - 33840084
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  33839997 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 33840084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 3796073 - 3795995
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  3796073 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 3795995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 3796139 - 3796101
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  3796139 atttttgcctggatcgccctttcgggttttcgatccacc 3796101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 6880838 - 6880760
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  6880838 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 6880760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15752485 - 15752563
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  15752485 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 15752563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 18369159 - 18369237
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  18369159 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 18369237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 23632505 - 23632427
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  23632505 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 23632427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28655777 - 28655699
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28655777 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28655699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 30035960 - 30035882
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  30035960 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 30035882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 30158568 - 30158490
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  30158568 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 30158490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 32589903 - 32589981
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || | ||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  32589903 atttttgcctgaattgtcctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 32589981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 33881660 - 33881582
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33881660 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33881582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 41681239 - 41681161
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  41681239 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 41681161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 8659033 - 8659074
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  8659033 atttttgcctggatcgccctctcgggttttcgatccaccggg 8659074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 11330239 - 11330198
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||| ||||||||||||||||||||||||||||||||    
T  11330239 atttttgccaggatcgccctttcgggttttcgatccaccggg 11330198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 13436231 - 13436272
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||| |||||||||||||||||||||||||||    
T  13436231 atttttgcctggattgccctttcgggttttcgatccaccggg 13436272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15752419 - 15752460
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  15752419 atttttgcctggatcgccctttcgggttttcggtccaccggg 15752460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 20374383 - 20374460
Alignment:
Q  167 ttttgcctggatcgccctttcggg-ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |||||||| ||| ||||| ||||||||||| || | |||||||||| |||||||||| ||||||||    
T  20374383 ttttgcctggaccgcccttttggggttttcaatccaccgggatgctcttttttgcctaagccgcccttttgggttttc 20374460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28655843 - 28655802
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  28655843 atttttgcctggatcgccctttcgggttttcgacccaccggg 28655802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 30036026 - 30035985
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  30036026 atttttgcctggatcgccctttcgggttttcggtccaccggg 30035985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 30158634 - 30158593
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  30158634 atttttgcctggatcgccctttcgggttttcggtccaccggg 30158593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31819974 - 31820015
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  31819974 atttttgcctggatcgccctttcgggttttcaatccaccggg 31820015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33522983 - 33522942
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||| |||||||||||    
T  33522983 atttttgcctggatcgccctttcgggtttttgatccaccggg 33522942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33881726 - 33881685
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  33881726 atttttgcctggatcgccctctcgggttttcgatccaccggg 33881685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 34623120 - 34623079
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  34623120 atttttgcctggatcgccctttcgggttttcgacccaccggg 34623079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 37352271 - 37352352
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  37352271 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 37352352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37665046 - 37665087
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  37665046 atttttgcctggatcgccttttcgggttttcgatccaccggg 37665087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 37761580 - 37761539
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||| ||||||    
T  37761580 atttttgcctggatcgccctttcgggttttcgatcaaccggg 37761539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 262
Target Start/End: Complemental strand, 34471381 - 34471297
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  34471381 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 34471297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 24959875 - 24959962
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||| || |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  24959875 ccctaatttttgcctagaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 24959962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 37582584 - 37582505
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  37582584 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 37582505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5644332 - 5644254
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5644332 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5644254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 8659099 - 8659177
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8659099 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8659177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 9324010 - 9323932
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  9324010 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 9323932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 9544334 - 9544412
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  9544334 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 9544412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 11330173 - 11330095
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  11330173 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 11330095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 12138709 - 12138631
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  12138709 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 12138631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 13180420 - 13180498
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  13180420 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 13180498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 13318455 - 13318533
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  13318455 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 13318533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15652387 - 15652465
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  15652387 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 15652465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 18122043 - 18122121
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| || ||||||||||||||||    
T  18122043 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagctgccctttcgggttttc 18122121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 18494395 - 18494473
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  18494395 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 18494473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 22894950 - 22894872
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  22894950 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 22894872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 22895016 - 22894978
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||| ||||||||||||||||||||||||||||    
T  22895016 atttttgcctagatcgccctttcgggttttcgatccacc 22894978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 22953997 - 22954067
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 235  Q
    ||||||||||||| |||||||||  |||||| |||||||| || || |||||||||||| |||||| ||||    
T  22953997 atttttgcctggaccgccctttcaagttttcaatccaccgagacgctcatttttgcctaagccgccttttc 22954067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 23898403 - 23898325
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| ||| |||| ||||  || |||||||||||| ||||||||| |||||||||    
T  23898403 atttttgcctgaactgccctttcgggttgtcggtccagcggggtgctcatttttgcctaagccgcccttccgggttttc 23898325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24608775 - 24608697
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24608775 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24608697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24730504 - 24730426
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24730504 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24730426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 25206818 - 25206740
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25206818 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25206740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 25270974 - 25270896
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25270974 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25270896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 26486919 - 26486841
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26486919 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26486841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 30175000 - 30174922
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  30175000 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 30174922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 30941164 - 30941086
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  30941164 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 30941086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 33784016 - 33783938
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  33784016 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 33783938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 37665113 - 37665191
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  37665113 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 37665191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 37745949 - 37746027
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || ||||||||||||   |||||||||||||||||    
T  37745949 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaaatcgccctttcgggttttc 37746027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 43084791 - 43084713
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || |||||||| |||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  43084791 atttttgcctgaattgccctttctggttatcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 43084713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 222 - 310
Target Start/End: Original strand, 349655 - 349746
Alignment:
Q  222 taggccgccctttcgggttttcgacctaccacgctgttctttt---catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||| |||||||||||||||||||||||||    |||||||||    |||||||||| | |||||||||||||||  ||||| |||||||||    
T  349655 taggacgccctttcgggttttcgacctaccgaattgttcttttacatatatatctagacaaagtatttcttgactgcatcagaattcacagg 349746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 1803838 - 1803789
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  1803838 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 1803789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5644398 - 5644357
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||| || ||||||||||    
T  5644398 atttttgcctggatcgccctttcgggttgtcaatccaccggg 5644357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 7792536 - 7792487
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  7792536 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 7792487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 11808451 - 11808492
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  11808451 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 11808492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 12389769 - 12389818
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  12389769 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 12389818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 15781324 - 15781373
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  15781324 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 15781373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 20382550 - 20382509
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  20382550 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 20382509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 21693516 - 21693467
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  21693516 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 21693467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 21862384 - 21862425
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  21862384 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 21862425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24608841 - 24608800
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||| |||||||| ||||||||||||||||||||||||||    
T  24608841 attttttcctggatcaccctttcgggttttcgatccaccggg 24608800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 26084390 - 26084431
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  26084390 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 26084431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 27228650 - 27228691
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27228650 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27228691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 28849348 - 28849307
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  28849348 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 28849307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 28953405 - 28953486
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  |||||||| ||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  28953405 atttttgcctgaactgccctttcaggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 28953486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 31523856 - 31523807
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  31523856 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 31523807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 32589838 - 32589878
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
T  32589838 atttttgcctggatcgccctttc-ggttttcgatccaccggg 32589878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33784082 - 33784041
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  33784082 atttttgcatggatcgccctttcgggttttcgacccaccggg 33784041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 33839934 - 33839975
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  33839934 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 33839975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 36372617 - 36372666
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  36372617 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 36372666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 36997280 - 36997329
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  36997280 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 36997329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37745883 - 37745924
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||| |||||||||||||||||||| ||||||||||    
T  37745883 atttttgcctagatcgccctttcgggttttcaatccaccggg 37745924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 12389840 - 12389916
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  12389840 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctgttgcctaagccgccttttcaggttttc 12389916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 110
Target Start/End: Complemental strand, 34471394 - 34471338
Alignment:
Q  54 tttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||| ||| |||||||||||||||||| || || ||||||||||||| ||||||    
T  34471394 tttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatttttgcct 34471338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 1803772 - 1803725
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  1803772 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 1803725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 3480908 - 3480951
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||| ||||||||||||||||    
T  3480908 ccctaatttttacctggatcgcccttttgggttttcgatccacc 3480951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 7256580 - 7256627
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  7256580 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 7256627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 7792470 - 7792423
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  7792470 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 7792423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 11941142 - 11941189
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  11941142 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 11941189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 15781388 - 15781435
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15781388 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15781435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 24960667 - 24960722
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  24960667 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 24960722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 28848511 - 28848456
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  28848511 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 28848456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 31523787 - 31523740
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  31523787 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 31523740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 36372683 - 36372730
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  36372683 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 36372730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 36452020 - 36451941
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| | |||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  36452020 ttttgcctggaccacccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 36451941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 36997346 - 36997393
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  36997346 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 36997393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 2517600 - 2517522
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || || || ||||  || |||||||||||| ||| |||||||||||||||    
T  2517600 atttttgcctgaactgccctttcgggttgtcaattcagcggggtgctcatttttgcctaagccaccctttcgggttttc 2517522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 11555887 - 11555809
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  11555887 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcttttttgcctaagccgcccttccgggttttc 11555809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 13436297 - 13436375
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | || ||||||||||||||    
T  13436297 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgtcctttcgggttttc 13436375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 22992751 - 22992829
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| ||||||||| |||||||||    
T  22992751 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgcccttccgggttttc 22992829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 24064552 - 24064602
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| ||| |||||||||||||||||| || || |||||||||||||    
T  24064552 atttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatt 24064602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24976377 - 24976299
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  24976377 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagacgcccttccgggttttc 24976299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 27227697 - 27227739
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  27227697 ccctaatttttacctggaccgccctttcgggttttcgatccac 27227739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 31437991 - 31437913
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| || |  || |||| ||||||| ||||||||| |||||||||    
T  31437991 atttttgcctgaactgccctttcgggttttcaatccagcgaggtgctcattcttgcctaagccgcccttccgggttttc 31437913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 31820037 - 31820115
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||| |||| |||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31820037 atttttgcctgaactgccttttcaggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31820115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 33299071 - 33298993
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| || |||||| |||||||||    
T  33299071 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagctgcccttccgggttttc 33298993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 5437611 - 5437668
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  5437611 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 5437668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 7256515 - 7256564
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||| ||||||||||||  |||||||||||    
T  7256515 tccctaatttttgcctggaccgccttttcgggttttcagtccaccgggaa 7256564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 228
Target Start/End: Original strand, 7257278 - 7257339
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccg 228  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| ||||    
T  7257278 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccg 7257339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 11807500 - 11807537
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  11807500 tttttgcctggaccgccctttcgggtttttgatccacc 11807537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 11941085 - 11941126
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  11941085 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 11941126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 11941808 - 11941865
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  11941808 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 11941865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 12174688 - 12174725
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  12174688 tttttgcctggaccgccctttcgggtttttgatccacc 12174725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 12176455 - 12176500
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  12176455 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 12176500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 21863308 - 21863353
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  21863308 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 21863353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #212
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 23641642 - 23641605
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcga 197  Q
    |||| ||||||||||||| |||||||||||||||||||    
T  23641642 ccctaatttttgcctggaccgccctttcgggttttcga 23641605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #213
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 23641706 - 23641665
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  23641706 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 23641665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #214
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 23831175 - 23831216
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  23831175 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 23831216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #215
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 23831239 - 23831276
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcga 197  Q
    |||| ||||||||||||| |||||||||||||||||||    
T  23831239 ccctaatttttgcctggaccgccctttcgggttttcga 23831276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #216
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 24064566 - 24064651
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || ||||||| ||||| |||||||||| |||||||||||| ||||  |||||||||    
T  24064566 cgccctttcgggttttcagcccaccgagacgctcattttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 24064651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #217
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 26083414 - 26083451
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  26083414 tttttgcctggaccgccctttcgggtttttgatccacc 26083451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #218
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 26085218 - 26085263
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  26085218 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 26085263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #219
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 31523082 - 31523025
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  31523082 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 31523025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 58)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 3647083 - 3646794
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  3647083 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 3646984  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||    
T  3646983 gtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttctgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 3646884  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3646883 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3646794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 20334735 - 20335026
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||    
T  20334735 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcatttttgcctgagttgc 20334834  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20334835 atacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20334933  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  20334934 tgcctaggccgccctttcgggttttcgacctaccacactgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 20335026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 16202353 - 16202644
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16202353 gccagatatagttacttgcctct-gtttcaatctcatttttgcatgaaccgcccttgcgggttttcggctcatcgagacgctcattcttgcctgagttgt 16202451  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||    
T  16202452 gtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcggctttttgatccaccgggaagcgcatttt 16202551  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  16202552 tgcctaggccgccctttcgggttttcgacctaccacgatgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 16202644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 10968602 - 10968316
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  10968602 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 10968503  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  10968502 ttacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 10968406  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  10968405 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 10968316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 51644157 - 51643869
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  51644157 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 51644058  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  51644057 gtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 51643959  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  51643958 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 51643869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 41787632 - 41787917
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||    
T  41787632 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttcagggttttcggctcatcgagacgctcattcttgcctgagttgtgt 41787731  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  41787732 acaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 41787829  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  41787830 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 41787917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28591020 - 28590732
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  28591020 gccagatatagctacttgccttttatttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgatttgc 28590921  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28590920 gtacaatctcagcgagctttt-catatattttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28590822  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28590821 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28590732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 28 - 310
Target Start/End: Complemental strand, 20466706 - 20466428
Alignment:
Q  28 gttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  20466706 gttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcagctcatcgagacgctcattcttgcctgagttgcgtacaatctc 20466607  T
Q  128 agcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggcc 227  Q
    |||||||||||   |||||           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20466606 agcgagcttttcattattttttttttt---gtcccttattttt-cctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggcc 20466511  T
Q  228 gccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||    
T  20466510 gccctttcgggttttcgacctaccacgctgttcttttcacatatctaggcaaagtatttcttgactatatcagcattcacagg 20466428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 10951028 - 10950728
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  10951028 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 10950929  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng------------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
     |||||||||||||||||||| ||||||||                      |||||||||||||||||||| |||||||||||||||||||||||||||    
T  10950928 ttacaatctcagcgagctttt-catatttgttttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgg 10950830  T
Q  206 gaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattc 305  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||    
T  10950829 gaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcgttc 10950730  T
Q  306 ac 307  Q
    ||    
T  10950729 ac 10950728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28155665 - 28155388
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||| |||||||||||      |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  28155665 gccagatatagttacttgtcttttgtttca------tttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 28155572  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28155571 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28155478  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28155477 tgcctgggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28155388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 21892067 - 21892354
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  21892067 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 21892166  T
Q  118 gtacaatctcagcgagctttt--tcatatttg--nnnnnnnnnggtcccttatttttgcctggatcgccc-tttcgggttttcgatccaccgggaagcgc 212  Q
    |||||||||||||||||||||  | || ||||            ||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||    
T  21892167 gtacaatctcagcgagcttttcattatttttgttttttttttttgtcccttattttt-cctggaccgcccttttcgggttttcgatccaccgggaagcgc 21892265  T
Q  213 a-tttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||        ||||||||||||||||| ||||||||    
T  21892266 attttttgcctaggccgcccttttcgggttttcgacctaccacgctgttcttttcatatttct--------tatttcttgactatatcggcattcac 21892354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 260
Target Start/End: Complemental strand, 22491814 - 22491718
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgacctaccacgctgttc 260  Q
    ||||||||||||| |||||||||||||||||||||||||| || || || ||||||  || |||||||||| ||||||||||||||||  |||||||    
T  22491814 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcattttttgtttaagccgcccttttgggttttcgacctaccgagctgttc 22491718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 13456547 - 13456400
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  13456547 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 13456448  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  13456447 tataaaaatttagacaaagtatttcttgactgcatcagaattcacagg 13456400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 13469144 - 13469057
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| | ||||||||||||||| ||||||||||| || ||||||| || || ||||||||||||||||||||||    
T  13469144 ccctaatttttgcctggacctccctttcgggttttcaatccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 13469057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 165 - 293
Target Start/End: Original strand, 5626485 - 5626615
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||||||| |||||||||||| ||||  |||||||||    
T  5626485 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 5626584  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    || | || | ||| | |||||||||||||||    
T  5626585 ttaaaatttttagacaaagtatttcttgact 5626615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 13457181 - 13457105
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| ||||||||||||||||| ||||||||||| || | |||||||| | |||||||||| ||||||||    
T  13457181 ttttgcctggaccgccctttcgggttttcaatccaccgggacgctcttttttgccaaagccgcccttttgggttttc 13457105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 31557543 - 31557456
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  31557543 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 31557456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 3647742 - 3647701
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  3647742 atttttgcctggatcgccctttcgggttttcgatccaccggg 3647701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 10951687 - 10951646
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10951687 atttttgcctggatcgccctttcgggttttcgatccaccggg 10951646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16201696 - 16201737
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16201696 atttttgcctggatcgccctttcgggttttcgatccaccggg 16201737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 20334076 - 20334117
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20334076 atttttgcctggatcgccctttcgggttttcgatccaccggg 20334117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20467381 - 20467340
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20467381 atttttgcctggatcgccctttcgggttttcgatccaccggg 20467340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28591676 - 28591635
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28591676 atttttgcctggatcgccctttcgggttttcgatccaccggg 28591635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 41786970 - 41787011
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41786970 atttttgcctggatcgccctttcgggttttcgatccaccggg 41787011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 51644817 - 51644776
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  51644817 atttttgcctggatcgccctttcgggttttcgatccaccggg 51644776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 2337741 - 2337811
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| ||||||    
T  2337741 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgcc 2337811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28156257 - 28156179
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28156257 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28156179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 41787036 - 41787114
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  41787036 atttttgcctgaattgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 41787114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 10969195 - 10969114
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| || ||||||||||||| || || || ||||  || | |||||||||| ||||||||||||||||||||||    
T  10969195 atttttgcctgaattgccctttcgggttgtcaattcagcggggtgctcttttttgcctaagccgccctttcgggttttcgac 10969114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28156323 - 28156282
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  28156323 atttttgcctggatcgccctttcgggttttcgacccaccggg 28156282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 31545449 - 31545362
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||| ||||||||  |||||| ||| || || ||||||| || ||||||||||| ||||||||||    
T  31545449 ccctaatttttgcctggaccgcccttttgggttttcagtccaccaggacgctcattttttgcttaagccgccctttcaggttttcgac 31545362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 35073338 - 35073259
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  35073338 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 35073259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 3647676 - 3647598
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| || ||||||||| ||||||    
T  3647676 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagctgccctttcgtgttttc 3647598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 10951621 - 10951543
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  10951621 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 10951543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 21891419 - 21891457
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||| ||||    
T  21891419 atttttgcctggatcgccctttcgggttttcgattcacc 21891457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28591610 - 28591532
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  28591610 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 28591532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 51644751 - 51644673
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  51644751 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 51644673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 2338463 - 2338544
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| |  || |||||||||| | |||||| |||| ||||| ||||    
T  2338463 atttttgcctggaccgccctttcgggttttcagtccaccgaggcgctcatttttgcccaagccgccttttcaggtttgcgac 2338544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 2390026 - 2389947
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagc---gcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||||||||||||||||||  ||||||||||| ||      |||||||||| | |||||||||||||||||    
T  2390026 ttttgcctggatcgccctttcgggtttttaatccaccgggacgctttttttttttgcctaagtcgccctttcgggttttc 2389947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 5625727 - 5625776
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  5625727 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 5625776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 6200107 - 6200164
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||||||||||||||||| |||||||| |  || ||||||||||||| ||||||    
T  6200107 atttttgcatgaaccgcccttttgggttttcagtccaccgagacgctcatttttgcct 6200164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 10969261 - 10969220
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||| | ||||||||||||||||||||||||||||    
T  10969261 atttttgcctgaaccgccctttcgggttttcgatccaccggg 10969220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 31557607 - 31557566
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  31557607 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 31557566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 5625793 - 5625840
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  5625793 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 5625840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 6199407 - 6199454
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  6199407 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 6199454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 262
Target Start/End: Complemental strand, 9297302 - 9297219
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||| |||||| |  ||||||| || || |||||||||||| ||| || |||| |||||||||||||||  |||||||||    
T  9297302 cgcccttttgggtttgcagtccaccgagacgctcatttttgcctaagcctccttttcaggttttcgacctaccgagctgttctt 9297219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 31544654 - 31544599
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  31544654 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 31544599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 14815457 - 14815499
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||||| |||||||||||||||||  ||||||||||    
T  14815457 atttttgcctggaccgccctttcgggttttcagtccaccggga 14815499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 20334142 - 20334220
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| | |||||||||||||||||    
T  20334142 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagtcgccctttcgggttttc 20334220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 20467315 - 20467237
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || || ||||||||| | |||||||||||||||||    
T  20467315 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcagttttgcctaagtcgccctttcgggttttc 20467237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 1959611 - 1959530
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||| || |||||||||| ||||||  ||||||| || |  |||||||||||| |||||| |||| ||||| ||||    
T  1959611 atttttgcctagaccgccctttcgagttttcagtccaccgagacgttcatttttgcctaagccgccttttccggtttgcgac 1959530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 2337679 - 2337720
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  2337679 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 2337720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 14815384 - 14815433
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| | ||||||||||||||| |||||| |||||    
T  14815384 tccctaatttttgcctggacctccctttcgggttttcaatccacagggaa 14815433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 230
Target Start/End: Complemental strand, 19372964 - 19372899
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    ||||||||||||| |||||||||||||| ||  ||||||  || || |||||||||||| ||||||    
T  19372964 atttttgcctggaccgccctttcgggttgtcagtccaccaagacgctcatttttgcctaagccgcc 19372899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 31545511 - 31545470
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  31545511 ttttacctggaccgccctttcgggttttcaatccaccgggaa 31545470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 35074111 - 35074070
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  35074111 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 35074070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 84
Target Start/End: Complemental strand, 10969262 - 10969230
Alignment:
Q  52 catttttgcatgaaccgccctttcgggttttcg 84  Q
    ||||||||| |||||||||||||||||||||||    
T  10969262 catttttgcctgaaccgccctttcgggttttcg 10969230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 21454647 - 21454687
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  21454647 ttttgcctggaccgccctttcgggttttcagtccaccggga 21454687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 252)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 310
Target Start/End: Original strand, 16618848 - 16619143
Alignment:
Q  12 tgatgtgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||     
T  16618848 tgatttgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttaccta 16618947  T
Q  112 agttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 211  Q
    ||||||||||||||||||||||||||||||||||||          |||||||||||| ||||||| ||||||||||||||||||||||||| |||||||    
T  16618948 agttgcgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttt-gcctggaccgccctttcgggttttcgatccacccggaagcg 16619044  T
Q  212 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  16619045 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 16619143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5716966 - 5716684
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5716966 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 5716867  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5716866 gtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5716774  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5716773 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5716684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 5764492 - 5764774
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5764492 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 5764591  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5764592 gtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5764684  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5764685 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5764774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 47029348 - 47029063
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  47029348 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 47029249  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  47029248 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 47029150  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  47029149 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 47029063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5727876 - 5727594
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5727876 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 5727777  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5727776 gtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5727684  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5727683 tgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5727594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 22 - 310
Target Start/End: Complemental strand, 19700381 - 19700096
Alignment:
Q  22 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtac 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||| |||||||||||||||||||||    
T  19700381 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccaggtttacggctcatcgagacgcttattcttgcctgagttgcgtac 19700282  T
Q  122 aatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcc 221  Q
    ||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  19700281 aatctcagcgagctttttcatatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcc 19700185  T
Q  222 taggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
T  19700184 taggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttgactatatcagcattcacagg 19700096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 16422080 - 16421792
Alignment:
Q  19 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 118  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16422080 ccagatatagttacttgccttt-gtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 16421982  T
Q  119 tacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    |||||||||||||||||||| ||||||||         | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  16421981 tacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattttt 16421884  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||||||||||    
T  16421883 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatattcctaggcaaagtatttcttgactatatcagcattcacagg 16421792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 18248636 - 18248351
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  18248636 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 18248537  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18248536 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18248441  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18248440 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18248351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 15887069 - 15887358
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| | ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  15887069 gccagatatagttacttgcctctcgtttcaatctcatttttccatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 15887168  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  15887169 gtacaatctcagcgagctttttcatatattttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 15887265  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  15887266 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcacagg 15887358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 5019609 - 5019324
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  5019609 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 5019510  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  5019509 acaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 5019412  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5019411 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5019324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4629683 - 4629395
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  4629683 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 4629584  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| || |||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
T  4629583 atacaatctcagcgagctttt-cacatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgtatttt 4629485  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4629484 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4629395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5472886 - 5472598
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  5472886 gccaggtatagctacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 5472787  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5472786 gtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5472688  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5472687 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5472598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 5590723 - 5591007
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  5590723 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 5590822  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
T  5590823 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaaacgcatttt 5590917  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  5590918 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 5591007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 8283831 - 8284119
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||     
T  8283831 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgtctgagttgt 8283930  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  8283931 gtacaatctcagcgagctttttcatatatatttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 8284029  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  8284030 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 8284119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 17971226 - 17971511
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  17971226 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 17971325  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  17971326 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 17971421  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  17971422 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 17971511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 18231091 - 18230806
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||| |||||||||||||    
T  18231091 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcatttttgcctgagttgc 18230992  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    | ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18230991 gaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18230896  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18230895 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18230806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 29143119 - 29143406
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||     
T  29143119 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcgattcatcgagacgctcattcttgcctgagttgt 29143218  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29143219 gtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 29143316  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  29143317 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 29143406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 48471825 - 48471537
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  48471825 gccagatatagttacttgccttttgtttcaatctcattcttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 48471726  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  48471725 ttacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 48471627  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  48471626 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 48471537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 22865208 - 22865498
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22865208 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 22865307  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||||||||||||||||||||| ||||||||            |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||    
T  22865308 gtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatt 22865406  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  22865407 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 22865498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 22880267 - 22880557
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22880267 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 22880366  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||||||||||||||||||||| ||||||||            |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||    
T  22880367 gtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatt 22880465  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  22880466 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 22880557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 29659330 - 29659620
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  29659330 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 29659429  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    ||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  29659430 gtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 29659528  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  29659529 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 29659620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 8002456 - 8002170
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  8002456 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 8002357  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  8002356 acaatctcagcgagctttt-catatatattttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 8002258  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  8002257 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 8002170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 51787918 - 51787633
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||    
T  51787918 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcattgagacgctcattcttgcctgagttgtgt 51787819  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  51787818 acaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 51787721  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  51787720 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 51787633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 4689549 - 4689262
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcattttt-gcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttg 116  Q
    ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  4689549 gccagatatagttacttgcctcttgtttcaatctcattttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttg 4689450  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
     ||||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4689449 tgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 4689356  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  4689355 ttgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcacagg 4689262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 5603677 - 5603964
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  5603677 gccagatatagtcacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 5603776  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5603777 gtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5603874  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5603875 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5603964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 20071933 - 20071650
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  20071933 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 20071834  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20071833 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20071740  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  20071739 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 20071650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 20571208 - 20571493
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  20571208 gccagatatagttacttgccttttgtttcaatctcatttttgcgtgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 20571307  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20571308 ttacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20571403  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  20571404 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 20571493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 22381941 - 22382228
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22381941 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 22382040  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  22382041 gtacaatctcagcgagctttt-catatatatttttttgtg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 22382138  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  22382139 tgcctaggccgccctttcgggttttcgacctaccacgttgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 22382228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 28110318 - 28110604
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||     
T  28110318 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcggctcatcgagacgctcattcttgcctgagttgt 28110417  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28110418 gttcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28110514  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||    
T  28110515 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcggcattcac 28110604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31958819 - 31959105
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||     
T  31958819 gccagatatagtcacttgccttttgtttcaatctcatttttgcatgaaccgcccctccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31958918  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31958919 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31959015  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31959016 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31959105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 10648967 - 10648683
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  10648967 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 10648868  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  10648867 acaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 10648771  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10648770 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10648683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 21680597 - 21680313
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  21680597 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 21680498  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| || |||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  21680497 acaatctcagcgagctttt-cacatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 21680401  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  21680400 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 21680313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 5658030 - 5657747
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||    
T  5658030 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcagctcatcgagacgctcattcttgcctgagttgtgta 5657931  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  5657930 caatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 5657834  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  5657833 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 5657747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 6207798 - 6207514
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  6207798 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 6207699  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  6207698 gtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 6207604  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||| ||||||||    
T  6207603 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttgactatatcggcattcac 6207514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 8217530 - 8217244
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||    
T  8217530 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcattgagacgctcattcttgcctgagttgc 8217431  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  8217430 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 8217334  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  8217333 tgcctaggtcgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 8217244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 17979315 - 17979599
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  17979315 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 17979414  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  17979415 ttacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 17979509  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  17979510 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 17979599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 22 - 307
Target Start/End: Complemental strand, 18057154 - 18056872
Alignment:
Q  22 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtac 121  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  18057154 gatatagttacttgccttttgttttaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgtgtac 18057055  T
Q  122 aatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcc 221  Q
    ||||||||||||||||| ||||| |           ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  18057054 aatctcagcgagctttt-catatatatttttttt--gtcacttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcc 18056958  T
Q  222 taggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  18056957 taggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 18056872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18286716 - 18287003
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||     
T  18286716 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacactcattcttgcctgagttgt 18286815  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18286816 gttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18286913  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18286914 tgcctaggccgccctttcgggttttcgacctaccatgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18287003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18302017 - 18302304
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||     
T  18302017 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacactcattcttgcctgagttgt 18302116  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18302117 gttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18302214  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18302215 tgcctaggccgccctttcgggttttcgacctaccatgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18302304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28345069 - 28344786
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||     
T  28345069 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacactcattcttgcctgagttgt 28344970  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
T  28344969 gtacaatctcagcgagctttt-catatttgttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccaggaagcgcatttt 28344876  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||  |||||||    
T  28344875 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcgacattcac 28344786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31030600 - 31030886
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  31030600 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 31030699  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||    
T  31030700 gtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgagttttcgatccaccgggaagcgcatttt 31030796  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  31030797 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 31030886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 35886662 - 35886376
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  35886662 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 35886563  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
T  35886562 gtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctatcgggttttcgatccaccgggaagcgcatttt 35886466  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  35886465 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 35886376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 32445052 - 32444761
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  32445052 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 32444953  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    || |||||||||||||||||||||||| |             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  32444952 gtgcaatctcagcgagctttttcatatatatatatattttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 32444853  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  32444852 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 32444761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 10402047 - 10401754
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  10402047 gccagatatagttacttgcctttggtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 10401948  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-----gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc 212  Q
    ||||||||||||||||||||| ||||||||               |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  10401947 gtacaatctcagcgagctttt-catatttgtttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgc 10401849  T
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10401848 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10401754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 4341039 - 4341326
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  4341039 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 4341138  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4341139 gtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 4341236  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  4341237 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 4341326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 11104724 - 11105009
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||    
T  11104724 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccaggttttcggctcatcgagacgctcattcttgcctgagttgc 11104823  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || ||||||||||||||||||||| || |           |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  11104824 gtgcaatctcagcgagctttttcaaatattttttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11104919  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  11104920 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 11105009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 18336526 - 18336240
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
T  18336526 gccagatatagttacttgcctttcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgc 18336427  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || || ||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18336426 gtgcactctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18336330  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18336329 tgcctaggccgccctttcgagttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18336240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4422817 - 4422525
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  4422817 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 4422718  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggt----cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca 213  Q
    ||||||||||||||||||||| ||||||||           |    |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  4422717 gtacaatctcagcgagctttt-catatttgttttttttttttttatcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgca 4422619  T
Q  214 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4422618 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4422525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 4790998 - 4791285
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
T  4790998 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgaggcgctcattcttgcctgagttgcgt 4791097  T
Q  120 acaatctcagcgagctttttc---atatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||||||||||||||||||||    ||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4791098 acaatctcagcgagcttttttcaaatatttttttttgt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 4791194  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  4791195 ttgcctaggctgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 4791285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 6537107 - 6537391
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  6537107 cagatatagttacttgccttttgtttcgatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 6537206  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  6537207 acaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 6537303  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  6537304 cctaggccgccctttcggcttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 6537391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 32296527 - 32296238
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  32296527 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 32296428  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||| ||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  32296427 gtataatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 32296329  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  32296328 ttgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 32296238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 4727531 - 4727240
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  4727531 gccagatatagttacttgccttttgtttcaatcccatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 4727432  T
Q  118 gtacaatctcagcgagctttttcatatt--tgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt 215  Q
    || ||||||||||||||||||||||||   |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  4727431 gtgcaatctcagcgagctttttcatatagatatattttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatt 4727332  T
Q  216 tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  4727331 tttgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 4727240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28027189 - 28026891
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  28027189 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 28027090  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng----------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||||||||||||| |||||||                     |||||||||||||||||||| |||||||||||||||||||||||||||||    
T  28027089 gtacaatctcagcgagctttt-catattttttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccggga 28026991  T
Q  208 agcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28026990 agcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28026891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 15735460 - 15735744
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||| |||    
T  15735460 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgtctaagttgtgta 15735559  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
T  15735560 caatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttac 15735657  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  15735658 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 15735744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 24334071 - 24333773
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  24334071 gccagatatagttacttgccttttgtttcattctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 24333972  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng----------gtcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
     |||||||||||||||||||| ||| ||||                    |||||||||||||||||||| |||||||||||||||||||||||||||||    
T  24333971 atacaatctcagcgagctttt-catttttgttttttttttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccggga 24333873  T
Q  208 agcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  24333872 agcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 24333773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 158 - 307
Target Start/End: Complemental strand, 7078965 - 7078816
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 257  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7078965 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 7078866  T
Q  258 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||| | ||||| ||||||||| |||||||||| ||||||||    
T  7078865 ttcttttcatatttttaggcaaagtatttcctgactatatcggcattcac 7078816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 18 - 147
Target Start/End: Complemental strand, 7079122 - 7078994
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||     
T  7079122 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgcttattcttgcctgagttgt 7079023  T
Q  118 gtacaatctcagcgagctttttcatatttg 147  Q
    ||||||||||||||||| ||||||||||||    
T  7079022 gtacaatctcagcgagc-ttttcatatttg 7078994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 11922890 - 11923035
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  11922890 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 11922989  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  11922990 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 11923035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 22962181 - 22962036
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  22962181 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 22962082  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  22962081 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 22962036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 6574084 - 6573937
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgtt-ctt 262  Q
    |||||||||||||||||||||||||||||||||||||||  || || ||||||| |  || |||||||||||||||||||||||||||  |||||| |||    
T  6574084 atttttgcctggatcgccctttcgggttttcgatccaccaagacgctcatttttggtttaagccgccctttcgggttttcgacctaccgagctgttcctt 6573985  T
Q  263 ttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  6573984 tatatatatttagacaaagtatttcttgactgcatcagaattcacagg 6573937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 7086577 - 7086721
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  7086577 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 7086676  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
      |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  7086677 --atatatttagacaaagtatttcttgactgcatcagaattcacagg 7086721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 27561342 - 27561489
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  27561342 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 27561441  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | |||| ||| | |||||||||||||||  ||||| ||| |||||    
T  27561442 tatacatatttagacaaagtatttcttgactgcatcagaatttacagg 27561489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 17931223 - 17931137
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||| ||||||||||||||||  |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  17931223 ccctaatttttgcctggattgccctttcgggttttcagtccaccaggatgctcatttttgcctaagccgccctttcgggttttcgac 17931137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 37258241 - 37258340
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  37258241 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 37258340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 165 - 293
Target Start/End: Complemental strand, 46383064 - 46382934
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| ||||||||| |||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  46383064 atttttgcctggaccgcccttttcgggttttcaatccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 46382965  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    || | || | ||| | |||||||||||||||    
T  46382964 ttaaaatttttagacaaagtatttcttgact 46382934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 25268999 - 25268912
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  25268999 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 25268912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 165 - 293
Target Start/End: Complemental strand, 15707203 - 15707073
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgtt-ctt 262  Q
    ||||||||||||| |||||||||||||||||   |||||| || || ||||||||  | | |||||||||||||||||||||||||||  |||||| |||    
T  15707203 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatttttggtttaagccgccctttcgggttttcgacctaccgagctgttcctt 15707104  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    |  |||| ||||| | |||||||||||||||    
T  15707103 tatatatgtctagacaaagtatttcttgact 15707073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 8609948 - 8609867
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  8609948 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 8609867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 308
Target Start/End: Original strand, 18904732 - 18904877
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||| |||||| ||||||||  ||||||||||    
T  18904732 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcaggtttttgacctaccgagctgttcttt 18904831  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcaca 308  Q
    |  | |||| ||| | || ||||||||||||  ||||| |||||||    
T  18904832 tatacatatttagacaaaatatttcttgactgcatcagaattcaca 18904877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 4453127 - 4453051
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || |||||||||||||| |||||| |||| || | |||||||||| |||||||||||||||||||    
T  4453127 ttttgcctggaccgtcctttcgggttttcaatccactgggacgctcttttttgcctaagccgccctttcgggttttc 4453051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 4452505 - 4452358
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    |||||||| |||| |||||||||||||||||  ||||||| || || ||||||| |  |||||| ||||||| | |||||||||||||  ||||||||||    
T  4452505 atttttgcttggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccaccctttcagattttcgacctaccgagctgttcttt 4452406  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  4452405 tataaatatttagacaaagtatttcttgactgcatcagaattcacagg 4452358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 310
Target Start/End: Original strand, 6960964 - 6961110
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-c 265  Q
    |||||| |||| |||| ||||||||||||  |||| || || || | ||||||  |||| |||||| ||||||||||||||||||  ||||||||||| |    
T  6960964 ttttgcatggaccgccttttcgggttttcagtccatcgagacgctcttttttgtttaggacgccctatcgggttttcgacctaccgagctgttcttttac 6961063  T
Q  266 a--tatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  ||||||||| | |||||||||||||||  ||||| |||||||||    
T  6961064 atgtatatctagacaaagtatttcttgactgcatcagaattcacagg 6961110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 10717369 - 10717456
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  10717369 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 10717456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 30091454 - 30091537
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  30091454 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 30091537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 5603083 - 5603161
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  5603083 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 5603161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 293
Target Start/End: Original strand, 5948332 - 5948462
Alignment:
Q  165 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  5948332 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 5948431  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
    || |  | | ||| | |||||||||||||||    
T  5948432 ttaaagtttttagacaaagtatttcttgact 5948462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 8218126 - 8218048
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8218126 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8218048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 10402638 - 10402560
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  10402638 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 10402560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 22864618 - 22864696
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| |||||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22864618 atttttgcctgaactgccctttcgggttgtcgatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22864696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 22879677 - 22879755
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| |||||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22879677 atttttgcctgaactgccctttcgggttgtcgatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22879755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28027779 - 28027701
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28027779 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28027701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28345660 - 28345582
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28345660 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28345582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 31958225 - 31958303
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31958225 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31958303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 71886 - 71805
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  71886 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 71805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 4340380 - 4340421
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4340380 atttttgcctggatcgccctttcgggttttcgatccaccggg 4340421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4690201 - 4690160
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4690201 atttttgcctggatcgccctttcgggttttcgatccaccggg 4690160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5473543 - 5473502
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5473543 atttttgcctggatcgccctttcgggttttcgatccaccggg 5473502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5590061 - 5590102
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5590061 atttttgcctggatcgccctttcgggttttcgatccaccggg 5590102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5603017 - 5603058
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5603017 atttttgcctggatcgccctttcgggttttcgatccaccggg 5603058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5658687 - 5658646
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5658687 atttttgcctggatcgccctttcgggttttcgatccaccggg 5658646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5717625 - 5717584
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5717625 atttttgcctggatcgccctttcgggttttcgatccaccggg 5717584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5728535 - 5728494
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5728535 atttttgcctggatcgccctttcgggttttcgatccaccggg 5728494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5763833 - 5763874
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5763833 atttttgcctggatcgccctttcgggttttcgatccaccggg 5763874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 6208450 - 6208409
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6208450 atttttgcctggatcgccctttcgggttttcgatccaccggg 6208409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 7079783 - 7079742
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  7079783 atttttgcctggatcgccctttcgggttttcgatccaccggg 7079742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 8218192 - 8218151
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  8218192 atttttgcctggatcgccctttcgggttttcgatccaccggg 8218151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 10402704 - 10402663
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10402704 atttttgcctggatcgccctttcgggttttcgatccaccggg 10402663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 11104066 - 11104107
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11104066 atttttgcctggatcgccctttcgggttttcgatccaccggg 11104107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 167 - 293
Target Start/End: Original strand, 15581640 - 15581768
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctttt 264  Q
    ||||||||||| |||||||||||||||||  ||||||| || ||  ||||||||||| ||||||  |||| ||||||||||| ||||  ||||||||| |    
T  15581640 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctaatttttgcctaagccgccctcttttgggttttcgacttaccgagctgttcttgt 15581739  T
Q  265 catatatctaggcgaagtatttcttgact 293  Q
     | || | ||| | |||||||||||||||    
T  15581740 aagatttttagacaaagtatttcttgact 15581768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15734817 - 15734858
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15734817 atttttgcctggatcgccctttcgggttttcgatccaccggg 15734858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15886445 - 15886486
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15886445 atttttgcctggatcgccctttcgggttttcgatccaccggg 15886486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16422740 - 16422699
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16422740 atttttgcctggatcgccctttcgggttttcgatccaccggg 16422699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16618207 - 16618248
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16618207 atttttgcctggatcgccctttcgggttttcgatccaccggg 16618248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 17970570 - 17970611
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17970570 atttttgcctggatcgccctttcgggttttcgatccaccggg 17970611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 17978652 - 17978693
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17978652 atttttgcctggatcgccctttcgggttttcgatccaccggg 17978693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 18231683 - 18231602
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18231683 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18231602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 18231749 - 18231708
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18231749 atttttgcctggatcgccctttcgggttttcgatccaccggg 18231708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 18249293 - 18249252
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18249293 atttttgcctggatcgccctttcgggttttcgatccaccggg 18249252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 18286125 - 18286206
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18286125 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18286206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 18301426 - 18301507
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18301426 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18301507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 18337179 - 18337138
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18337179 atttttgcctggatcgccctttcgggttttcgatccaccggg 18337138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 20570552 - 20570593
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20570552 atttttgcctggatcgccctttcgggttttcgatccaccggg 20570593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 21681256 - 21681215
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  21681256 atttttgcctggatcgccctttcgggttttcgatccaccggg 21681215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22864552 - 22864593
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22864552 atttttgcctggatcgccctttcgggttttcgatccaccggg 22864593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22879611 - 22879652
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22879611 atttttgcctggatcgccctttcgggttttcgatccaccggg 22879652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24334731 - 24334690
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24334731 atttttgcctggatcgccctttcgggttttcgatccaccggg 24334690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28027845 - 28027804
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28027845 atttttgcctggatcgccctttcgggttttcgatccaccggg 28027804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 29142458 - 29142499
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29142458 atttttgcctggatcgccctttcgggttttcgatccaccggg 29142499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 29658672 - 29658713
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29658672 atttttgcctggatcgccctttcgggttttcgatccaccggg 29658713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31958159 - 31958200
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31958159 atttttgcctggatcgccctttcgggttttcgatccaccggg 31958200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 35887316 - 35887275
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  35887316 atttttgcctggatcgccctttcgggttttcgatccaccggg 35887275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 47030010 - 47029969
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  47030010 atttttgcctggatcgccctttcgggttttcgatccaccggg 47029969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 48472487 - 48472446
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  48472487 atttttgcctggatcgccctttcgggttttcgatccaccggg 48472446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 158 - 246
Target Start/End: Original strand, 3240297 - 3240385
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||| ||||||||||||| |||  |||||||||||   |||||||||| || ||||||||| || |||||||||| |||||||||||    
T  3240297 gtccctaatttttgcctggaccgcgatttcgggtttttagtccaccgggacgctcatttttgcttaagccgcccttttgggttttcgac 3240385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 15532445 - 15532524
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15532445 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15532524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 293
Target Start/End: Complemental strand, 15921219 - 15921089
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||  |||| || |||||||| ||||  |||||||||    
T  15921219 atttttgcctggaccgccctttcgggttttcagtccaccgagatgctcatttttgcctaagtcgccctcttttggattttcgacttaccgagctgttctt 15921120  T
Q  263 ttcatatatctaggcgaagtatttcttgact 293  Q
     | | || | ||| | |||||||||||||||    
T  15921119 gtaagatttttagacaaagtatttcttgact 15921089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 23283719 - 23283802
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| | |||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  23283719 ccctaatttttgcctggaccaccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 23283802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 246
Target Start/End: Complemental strand, 3681471 - 3681389
Alignment:
Q  164 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||||||| |||||||||||||||||   |||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  3681471 tatttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3681389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 4340446 - 4340524
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4340446 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4340524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4630274 - 4630196
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4630274 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4630196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5020202 - 5020124
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  5020202 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 5020124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5473477 - 5473399
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  5473477 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 5473399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 6208387 - 6208309
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  6208387 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 6208309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 8283228 - 8283306
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8283228 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8283306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 10649561 - 10649483
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  10649561 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 10649483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 18249227 - 18249149
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| |  ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  18249227 atttttgcctgaattgccctttcgggttattaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 18249149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 21681190 - 21681112
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  21681190 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 21681112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 22381351 - 22381429
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22381351 atttttgcctgaactgccctttcgggttgtcaatccaacggggtgctcatttttgcctaagccgccctttcgggttttc 22381429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24334665 - 24334587
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||| ||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  24334665 atttttgcctgaactgccccttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 24334587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 29142524 - 29142602
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||| |||||||||    
T  29142524 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgcccttccgggttttc 29142602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 29658738 - 29658816
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29658738 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29658816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 246
Target Start/End: Complemental strand, 30018027 - 30017945
Alignment:
Q  164 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||||||||| |||||||||||||||||   |||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  30018027 tatttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 30017945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 48472421 - 48472343
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  48472421 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 48472343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 51788511 - 51788433
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  51788511 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 51788433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 3408762 - 3408681
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||| || |||| ||||| ||||    
T  3408762 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccaccttttcaggtttgcgac 3408681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4423474 - 4423433
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  4423474 atttttgcctagatcgccctttcgggttttcgatccaccggg 4423433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4630340 - 4630299
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  4630340 atttttgcttggatcgccctttcgggttttcgatccaccggg 4630299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 4728181 - 4728140
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||| |||||||||||||||||||||||||||||||||||    
T  4728181 atttttacctggatcgccctttcgggttttcgatccaccggg 4728140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 4790337 - 4790378
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  4790337 atttttgcctggatcgccctttcgggttttcaatccaccggg 4790378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5020268 - 5020227
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  5020268 atttttgcctggatcgccctttcgggttttcggtccaccggg 5020227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 8283162 - 8283203
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  8283162 atttttgcctggatcgccctttcgggttttcgatccatcggg 8283203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 10649627 - 10649586
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  10649627 atttttgcctggatcgccctttcgggttttcggtccaccggg 10649586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 247
Target Start/End: Complemental strand, 15707884 - 15707801
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt---gcctaggccgccctttcgggttttcgacc 247  Q
    ||||||||||| ||||||||||||||||||||||| ||||  || | |||||   |  ||||||||||||||||||||||||||    
T  15707884 ttttgcctggaccgccctttcgggttttcgatccatcggggcgctcctttttttggtttaggccgccctttcgggttttcgacc 15707801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 310
Target Start/End: Original strand, 17437928 - 17438012
Alignment:
Q  225 gccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||| |||||||||||||||  ||||||||||| |||||| ||| | |||||||||||||||  ||||  |||||||||    
T  17437928 gccgccctttcaggttttcgacctaccgagctgttctttt-atatatttagacaaagtatttcttgactgcatcataattcacagg 17438012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18286059 - 18286100
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  18286059 atttttgcctggatcgccctttcgggttttcgacccaccggg 18286100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18301360 - 18301401
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  18301360 atttttgcctggatcgccctttcgggttttcgacccaccggg 18301401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20072591 - 20072550
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  20072591 atttttgcctggatcgccctttcgggttttcgacccaccggg 20072550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22381285 - 22381326
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||| |||||||||||||||||||    
T  22381285 atttttgcctggatcgcccttttgggttttcgatccaccggg 22381326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 28109655 - 28109696
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  28109655 atttttgcctggatcgccctttcgggttttcaatccaccggg 28109696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28345726 - 28345685
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||| ||||||||||||||||||||    
T  28345726 atttttgcctggatcgcccttccgggttttcgatccaccggg 28345685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31029948 - 31029989
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  31029948 atttttgcctggatcgccctttcgggttttcgacccaccggg 31029989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 32297186 - 32297149
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccac 202  Q
    ||||||||||||||||||||||||||||||||||||||    
T  32297186 atttttgcctggatcgccctttcgggttttcgatccac 32297149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 32445705 - 32445664
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
T  32445705 atttttgtctggatcgccctttcgggttttcgatccaccggg 32445664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 51788577 - 51788536
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  51788577 atttttgcctggatcgccctttcgggttttcgacccaccggg 51788536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 72614 - 72530
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || |||||||||| |||||| |||| |||||||    
T  72614 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttgcctaagccgccttttcaggttttc 72530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 6536447 - 6536487
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
    |||||||||||||||||||||||| ||||||||||||||||    
T  6536447 atttttgcctggatcgccctttcgagttttcgatccaccgg 6536487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 15580893 - 15580933
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||||||||||||||    
T  15580893 ttttgcctggaccgccctttcgggttttcgatccaccggga 15580933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 262
Target Start/End: Complemental strand, 20445830 - 20445746
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  20445830 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 20445746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 15624618 - 15624539
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  | ||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15624618 ttttgcctggaccgccctttcgggttttcagttcaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15624539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 41003773 - 41003686
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||| ||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  41003773 ccctaatttttgcctggaccgccttttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 41003686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 41012554 - 41012467
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||| ||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  41012554 ccctaatttttgcctggaccgccttttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 41012467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4423408 - 4423330
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4423408 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4423330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4728118 - 4728040
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4728118 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4728040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 4790403 - 4790481
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  4790403 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 4790481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 5590127 - 5590205
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5590127 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5590205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5717559 - 5717481
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5717559 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5717481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5728469 - 5728391
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5728469 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5728391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 5763899 - 5763977
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5763899 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5763977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 6536513 - 6536591
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  6536513 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 6536591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 7079717 - 7079639
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| |||||||||||||||    
T  7079717 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccaccctttcgggttttc 7079639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 11104132 - 11104210
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||| |||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11104132 atttttgcctgaactgccctttcaggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11104210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15886511 - 15886589
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  15886511 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 15886589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 17970636 - 17970714
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  17970636 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 17970714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 17978718 - 17978796
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||| ||||||||||||||    
T  17978718 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgtcctttcgggttttc 17978796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 18057819 - 18057781
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||| ||||||||||||||||||||||||||||||||    
T  18057819 attttttcctggatcgccctttcgggttttcgatccacc 18057781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 18337112 - 18337034
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  18337112 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 18337034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 20072525 - 20072447
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  20072525 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 20072447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 23284455 - 23284525
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 235  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||||||| |||||| ||||    
T  23284455 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttc 23284525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 31030014 - 31030092
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||  | ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31030014 atttttgcctgaactgccctttcgggttgccaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31030092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 32445639 - 32445561
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  32445639 atttttgcctgaactgccctttcgggttgtcaatccagcgggttgctcatttttgcctaagtcgccctttcgggttttc 32445561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 47029944 - 47029866
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  47029944 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 47029866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 5947566 - 5947615
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  5947566 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 5947615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 6200136 - 6200087
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  6200136 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 6200087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 8200259 - 8200347
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt--gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||  || || ||| ||||| ||||||||||||    
T  8200259 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttggcttaagccacccttccgggttttcgac 8200347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 8810220 - 8810171
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  8810220 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 8810171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 10717305 - 10717346
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  10717305 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 10717346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 12475407 - 12475472
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||||||| ||||||    
T  12475407 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcc 12475472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 14661917 - 14661958
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||||||||||||||||||| ||||| ||||||    
T  14661917 ttttgcctggatcgccctttcgggttttcaatccatcgggaa 14661958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 20445844 - 20445787
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| ||| |||||||||||||||||| || || ||||||||||||| ||||||    
T  20445844 atttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatttttgcct 20445787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 25269063 - 25269022
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  25269063 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 25269022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 27560673 - 27560752
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc---atttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |||||||| |||||||| ||||||||||| || |    |||||||||| | |||||||||||||||||    
T  27560673 ttttgcctggaccgcccttttgggttttcaatccaccgggatgctctctttttttgcctaagtcgccctttcgggttttc 27560752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 30092174 - 30092239
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| ||||||    
T  30092174 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgcc 30092239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 32297120 - 32297043
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 242  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||    
T  32297120 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggtttt 32297043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46383839 - 46383790
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  46383839 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 46383790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 46395056 - 46395105
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  46395056 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 46395105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 7085888 - 7085928
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||||||||||||| |||||||| |||||||||||||||||    
T  7085888 ttttgcctggatcgtcctttcggattttcgatccaccggga 7085928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 18904132 - 18904207
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| |||||| |||||||| |||||||| |||||| |||| || | |||| ||||| |||||||||||||||||||    
T  18904132 tttttcctggaccgcccttttgggttttcaatccactgggatgctcctttt-gcctaagccgccctttcgggttttc 18904207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 3682177 - 3682130
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  3682177 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 3682130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 5947631 - 5947678
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  5947631 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 5947678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 6200069 - 6200022
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  6200069 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 6200022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 8622082 - 8622035
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  8622082 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 8622035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 13107374 - 13107421
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  13107374 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 13107421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 13108106 - 13108185
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| | |||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  13108106 ttttgcctggaccacccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 13108185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 15531757 - 15531804
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15531757 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15531804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 15580953 - 15581000
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15580953 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15581000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 15624618 - 15624563
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||| || ||||||||||||||||||| | ||| ||||||||||||| ||||||    
T  15624618 ttttgcctggaccgccctttcgggttttcagttcaccgagacgctcatttttgcct 15624563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 15921897 - 15921850
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| |||||||||||| ||||||||||||||||||  ||||||||||    
T  15921897 ccctaatttttgcctgggtcgccctttcgggttttcagtccaccggga 15921850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 22962827 - 22962784
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||| ||||||||||||||||||||||||||||    
T  22962827 ccctaatttttacctagatcgccctttcgggttttcgatccacc 22962784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 30018736 - 30018689
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  30018736 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 30018689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 41002982 - 41002927
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  41002982 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 41002927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 41011763 - 41011708
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  41011763 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 41011708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 46383774 - 46383727
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  46383774 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 46383727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 4690135 - 4690057
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  4690135 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 4690057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5658621 - 5658543
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  5658621 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 5658543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 11922203 - 11922245
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  11922203 ccctaatttttacctggaccgccctttcgggttttcgatccac 11922245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 15707203 - 15707153
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| || ||||||||||||||||||| || || |||||||||||||    
T  15707203 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatt 15707153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15734883 - 15734961
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  15734883 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 15734961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16422674 - 16422596
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||| |||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16422674 atttttgcctgaactgccctttcaggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16422596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 28109721 - 28109799
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||| | || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  28109721 atttttgcctgaactgccctttcggggtgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 28109799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 35887250 - 35887172
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||| || ||||||||||||| |||||    
T  35887250 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcgtaagccgccctttcggattttc 35887172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 71886 - 71829
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  71886 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 71829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 72682 - 72641
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  72682 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 72641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 266338 - 266301
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttc 195  Q
    |||||| ||||||||||||| |||||||||||||||||    
T  266338 gtccctaatttttgcctggaccgccctttcgggttttc 266301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 3408762 - 3408705
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  3408762 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 3408705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 3681470 - 3681413
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  3681470 atttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcct 3681413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 7085960 - 7085997
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||||| |||||||| ||||||||||||||||||||||    
T  7085960 atttttacctggatcaccctttcgggttttcgatccac 7085997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 8609948 - 8609891
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  8609948 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 8609891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 8622139 - 8622098
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  8622139 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 8622098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 10718148 - 10718193
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  10718148 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 10718193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #240
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 12573696 - 12573655
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  12573696 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 12573655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 13550160 - 13550119
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  13550160 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 13550119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 15531697 - 15531738
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  15531697 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 15531738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #243
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 21613684 - 21613643
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  21613684 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 21613643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 30018026 - 30017969
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  30018026 atttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcct 30017969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 37257511 - 37257552
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  37257511 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 37257552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 37258241 - 37258298
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  37258241 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 37258298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 41003835 - 41003794
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  41003835 ttttacctggaccgccctttcgggttttcaatccaccgggaa 41003794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 41012616 - 41012575
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  41012616 ttttacctggaccgccctttcgggttttcaatccaccgggaa 41012575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #249
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 8810148 - 8810108
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  8810148 ttttgcctggaccgccctttcgggttttcagtccaccggga 8810108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #250
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 12553974 - 12553910
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 229  Q
    |||||||| |||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||    
T  12553974 atttttgcttggaccgccctttctggttttcagtccaccgagacgctcatttttgcctaagccgc 12553910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #251
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 15679776 - 15679824
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||| | |||||||||||||| |||||||| |||| |||||||||||    
T  15679776 gtccctaacttttgcctggatcgtcctttcggattttggatccaccggg 15679824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #252
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 15921956 - 15921916
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||| |||| |||||    
T  15921956 ttttgcctggaccgccctttcgggttttcggtccatcggga 15921916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 91)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 307
Target Start/End: Original strand, 27603181 - 27603473
Alignment:
Q  12 tgatgtgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 111  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27603181 tgatttgccagatatagttacttgccttttgtttcaatctcgtttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctg 27603280  T
Q  112 agttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcg 211  Q
    ||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  27603281 agttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcg 27603377  T
Q  212 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||    
T  27603378 catttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaaatatttcttgactatatcagcattcac 27603473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 19694030 - 19693747
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  19694030 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 19693931  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  19693930 gtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 19693837  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  19693836 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 19693747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 28356234 - 28356520
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  28356234 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 28356333  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28356334 gtacaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28356430  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||    
T  28356431 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttgactatatcggcattcac 28356520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 19655625 - 19655911
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  19655625 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 19655724  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           ||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||    
T  19655725 gtacaatctcagcgagctttttcatatatttttt------gtcccttattttttcctggaccgccctttcgggttttcgatccaccaggaagcgcatttt 19655818  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  19655819 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcacagg 19655911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 19202648 - 19202930
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  19202648 agatatagttacttgccttgtgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 19202747  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||||||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  19202748 caatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 19202843  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  19202844 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 19202930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 12087005 - 12087291
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  12087005 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 12087104  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  12087105 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 12087201  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  12087202 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 12087291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 15773509 - 15773220
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  15773509 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 15773410  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  15773409 gtgcaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 15773313  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15773312 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 15773220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 33248299 - 33248018
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
T  33248299 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgcgt 33248200  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  33248199 acaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 33248106  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  33248105 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 33248018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 9360557 - 9360273
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||     
T  9360557 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgtgttttcggctcatcgagacgctcattcttgcctgagttgt 9360458  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9360457 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 9360363  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  9360362 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 9360273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 29835258 - 29834973
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  29835258 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 29835159  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29835158 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 29835063  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  29835062 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 29834973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 16260158 - 16259866
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||    
T  16260158 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagatgctcattcttgcctgagttgc 16260059  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16260058 gtacaatctcagcgagctttttcatatattatttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16259959  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||    
T  16259958 tgcctaggccgccccttcgggttttcgacataccacgctgttcttttcatatttctaagcaaagtatttcttgactatatcagcattcacagg 16259866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 31484155 - 31484439
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  31484155 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 31484254  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||| ||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  31484255 acaatctcagcgaactttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 31484351  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31484352 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31484439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 18715417 - 18715132
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  18715417 gccagatatagttacttgccttttgtttcaacctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 18715318  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18715317 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18715222  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  18715221 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 18715132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 19680383 - 19680095
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  19680383 gccaggtatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 19680284  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||| ||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  19680283 gtataatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 19680185  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  19680184 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 19680095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 33264666 - 33264382
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33264666 gccagatatagttacttgctttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 33264567  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  33264566 atacaatctcagcgagctttt-catatatttttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 33264472  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  33264471 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 33264382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 22138842 - 22138553
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||    
T  22138842 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctgatcgagacgctcattcttgcctgagttgc 22138743  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    |||||||||||||||||| |||||||| |           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
T  22138742 gtacaatctcagcgagctctttcatatatatattttt---gtcccttatttttgcctggaccgccctttcgggttttcaatccaccgggaagcgcatttt 22138646  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||    
T  22138645 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgaatatatcagcattcacagg 22138553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 2131545 - 2131828
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||  |    
T  2131545 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtat 2131644  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||    
T  2131645 acaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcccatttttg 2131740  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  2131741 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 2131828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 14569092 - 14568807
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||  |||||||||||||||||||||||||||||     
T  14569092 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggtacatcgagacgctcattcttgcctgagttgt 14568993  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  14568992 gtacaatctcagcgagctttttcatatatctttttgt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 14568897  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  14568896 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 14568807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 21342452 - 21342739
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  21342452 gccagatatagtcacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 21342551  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  21342552 gtgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 21342649  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  21342650 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 21342739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 18796639 - 18796352
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||    
T  18796639 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccacccttccgggttttcggttcatcgagacgctcattcttgcctgagttgcgt 18796540  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
     |||||||||||||||||| ||||| |          | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  18796539 gcaatctcagcgagctttt-catatatatttttttttgtgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattttt 18796441  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18796440 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18796352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 31360463 - 31360177
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  31360463 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31360364  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31360363 gttcaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31360267  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| || ||||||||||||||||| ||||||||    
T  31360266 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaaatatttcttgactatatcggcattcac 31360177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 44566916 - 44566632
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  44566916 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 44566817  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  44566816 gtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 44566722  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  44566721 tgcataggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 44566632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 19911445 - 19911730
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||    
T  19911445 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccggattttcggttcatcgagacgctcattcttgcctgagttgc 19911544  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||| ||| |           |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  19911545 gtgcaatctcagcgagctttttcgtatatattttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 19911640  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  19911641 tgcctaggccgccctttcgggttttcgaccaaccacgttgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 19911730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 43 - 310
Target Start/End: Original strand, 22075235 - 22075496
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-ca 141  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||    
T  22075235 tttcaatctcatttttgcatgaaccgccatttcgggttttcggctcatcgagacgctcattcttgcctaagttgcgtacaatctcagcgagcttttttca 22075334  T
Q  142 tatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 241  Q
    | |||           |||||||||||| ||||||||||||  ||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||    
T  22075335 tttttttttt------gtcccttatttt-gcctggatcgccagttcgggttttcgacccaccgggaagcgcgtttttgccaaggccgccctttcgggttt 22075427  T
Q  242 tcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||| ||||||||||||||||||| |||||  | ||  |||||||||||||||| |||||||||||    
T  22075428 tcgaccttccacgctgttcttttcatacatctaaacaaacaatttcttgactatatcggcattcacagg 22075496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 14214805 - 14214660
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  14214805 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 14214706  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  14214705 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 14214660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 22414704 - 22414559
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  22414704 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 22414605  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  22414604 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 22414559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 187 - 307
Target Start/End: Complemental strand, 16288721 - 16288601
Alignment:
Q  187 cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtattt 286  Q
    |||||||||||||| || ||||| | | ||||||||||||| ||| ||||||||||| |||| ||||||||||||||| |||| | ||||| ||||||||    
T  16288721 cgggttttcgatccccccggaaggggaattttgcctaggcccccccttcgggttttccacctcccacgctgttctttttatatttttaggcaaagtattt 16288622  T
Q  287 cttgactatatcagcattcac 307  Q
     ||||||| ||| ||||||||    
T  16288621 tttgactaaatcggcattcac 16288601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 160 - 251
Target Start/End: Complemental strand, 19847615 - 19847523
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctacc 251  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||||  || | ||||| |  ||||||||||||||||||||||||||||||    
T  19847615 ccctaatttttgcctggaccgccctttcgggttttcgatccaccggggcgctcctttttggtttaggccgccctttcgggttttcgacctacc 19847523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 16771091 - 16770944
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  16771091 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 16770992  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  16770991 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 16770944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 19846933 - 19846784
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||   |||||| || || ||||||||  | |||||||||||||||||||||||||||||  | ||||||||    
T  19846933 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagttgttcttt 19846834  T
Q  264 t---catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |    |||||||||| | |||||||||||||||  ||| | |||||||||    
T  19846833 tatatatatatctagacaaagtatttcttgactgcatctgaattcacagg 19846784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 16771762 - 16771686
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  16771762 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 16771686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 28355639 - 28355720
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  28355639 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 28355720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 25794130 - 25794054
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |||||||| |||||||| ||||||||||| || | |||||||||| |||||||||| ||||||||    
T  25794130 ttttgcctggaccgcccttttgggttttcaatccaccgggatgctcttttttgcctaagccgcccttttgggttttc 25794054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 31483493 - 31483536
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  31483493 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 31483536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 31483559 - 31483637
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31483559 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31483637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 33265250 - 33265172
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33265250 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33265172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 9361200 - 9361159
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9361200 atttttgcctggatcgccctttcgggttttcgatccaccggg 9361159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 12086346 - 12086387
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12086346 atttttgcctggatcgccctttcgggttttcgatccaccggg 12086387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 19654968 - 19655009
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19654968 atttttgcctggatcgccctttcgggttttcgatccaccggg 19655009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 19694684 - 19694643
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19694684 atttttgcctggatcgccctttcgggttttcgatccaccggg 19694643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22074552 - 22074593
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22074552 atttttgcctggatcgccctttcgggttttcgatccaccggg 22074593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 22139480 - 22139439
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22139480 atttttgcctggatcgccctttcgggttttcgatccaccggg 22139439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27602537 - 27602578
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27602537 atttttgcctggatcgccctttcgggttttcgatccaccggg 27602578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 28355573 - 28355614
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28355573 atttttgcctggatcgccctttcgggttttcgatccaccggg 28355614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33248958 - 33248917
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33248958 atttttgcctggatcgccctttcgggttttcgatccaccggg 33248917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33265316 - 33265275
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33265316 atttttgcctggatcgccctttcgggttttcgatccaccggg 33265275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 17677678 - 17677765
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || |||| || || ||||||||||||||||||||||    
T  17677678 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcacttttggcttaagccgccctttcgggttttcgac 17677765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 22158751 - 22158834
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| || ||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  22158751 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 22158834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 243
Target Start/End: Complemental strand, 29835850 - 29835771
Alignment:
Q  164 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29835850 tatttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29835771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 39840292 - 39840379
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| |  ||||||| || || ||||||||||||||||||||||    
T  39840292 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgttcatttttggcttaagccgccctttcgggttttcgac 39840379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 18716009 - 18715931
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  18716009 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 18715931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 18797300 - 18797262
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||||||||||||||||||||||||||||    
T  18797300 atttttgcctggatcgccctttcgggttttcgatccacc 18797262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 21341859 - 21341937
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  21341859 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 21341937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 31361055 - 31360977
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  31361055 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 31360977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 206
Target Start/End: Original strand, 2130894 - 2130931
Alignment:
Q  169 ttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||    
T  2130894 ttgcctggatcgccctttcgggttttcgatccaccggg 2130931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 14569748 - 14569707
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
T  14569748 atttttgcctgaatcgccctttcgggttttcgatccaccggg 14569707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 15774167 - 15774126
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  15774167 atttttgcctggatcaccctttcgggttttcgatccaccggg 15774126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 18716075 - 18716034
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  18716075 atttttgcatggatcgccctttcgggttttcgatccaccggg 18716034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 19681040 - 19680999
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  19681040 atttttgcctggatcgccctttcgggttttcgatccatcggg 19680999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 19910785 - 19910826
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||| ||||||||||||||||||||||    
T  19910785 atttttgcctggatcgccccttcgggttttcgatccaccggg 19910826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 21341793 - 21341834
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  21341793 atttttgcctggatcgccctttcgggttttcgatccatcggg 21341834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 22090985 - 22091026
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  22090985 ttttgcctggatcgccctttcgggttttcaatccaccgggaa 22091026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 29835915 - 29835874
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  29835915 atttttgcctggatcgccctttcgggttttcaatccaccggg 29835874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31361121 - 31361080
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  31361121 atttttgcctggatcaccctttcgggttttcgatccaccggg 31361080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 44567576 - 44567535
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  44567576 atttttgcctggatcgccctttcgggttttcaatccaccggg 44567535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 12086412 - 12086490
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12086412 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12086490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 15774101 - 15774023
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  15774101 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 15774023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19202064 - 19202142
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  19202064 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 19202142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19655034 - 19655112
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  19655034 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 19655112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 19680974 - 19680896
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||| || |||||||||||||||||||    
T  19680974 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcttaagccgccctttcgggttttc 19680896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 22139414 - 22139336
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  22139414 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 22139336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27602603 - 27602681
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27602603 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27602681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 39840219 - 39840269
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  39840219 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 39840269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 44567510 - 44567432
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  44567510 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 44567432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 198
Target Start/End: Complemental strand, 16260505 - 16260472
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgat 198  Q
    ||||||||||||||||||||||||||||||||||    
T  16260505 atttttgcctggatcgccctttcgggttttcgat 16260472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 17677613 - 17677654
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  17677613 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 17677654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 19202000 - 19202037
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccg 204  Q
    |||||||||||||| |||||||||||||||||||||||    
T  19202000 ttttgcctggatcgtcctttcgggttttcgatccaccg 19202037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 32003969 - 32003888
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || ||||||| |||| |||||| |||| ||||| ||||    
T  32003969 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcattttttcctaagccgccttttcaggtttgcgac 32003888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 33248892 - 33248811
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| ||||||||||||    
T  33248892 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttcgac 33248811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 21477810 - 21477894
Alignment:
Q  160 cccttatttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||| |||| |||||||    
T  21477810 ccctaatttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgccatttcaggttttc 21477894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 19847676 - 19847637
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  19847676 ttttgcctggatcgtcctttcggattttcgatccaccggg 19847637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 243
Target Start/End: Original strand, 22074633 - 22074696
Alignment:
Q  180 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  22074633 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 22074696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 22159456 - 22159535
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||| |||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  22159456 ttttgcttggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 22159535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 14215449 - 14215407
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  14215449 ccctaatttttacctggaccgccctttcgggttttcgatccac 14215407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 18797234 - 18797156
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| | |||||||    
T  18797234 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccaggttttc 18797156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 19694618 - 19694540
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || |||||  |||  || |||||||||||| ||||||||| |||||||||    
T  19694618 atttttgcctgaactgccctttcgggttgtcaatccagaggggtgctcatttttgcctaagccgcccttccgggttttc 19694540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 19846933 - 19846883
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| || ||||||||||||||||||| || || |||||||||||||    
T  19846933 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatt 19846883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19910851 - 19910929
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || || ||||||||| ||||||||| |||||||||    
T  19910851 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcaattttgcctaagccgcccttccgggttttc 19910929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 20731866 - 20731824
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||||| |||||||||||||||||  ||||||||||    
T  20731866 atttttgcctggaccgccctttcgggttttcagtccaccggga 20731824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 17678418 - 17678463
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  17678418 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 17678463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 22415447 - 22415411
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||||||||||||| |||||||| |||||||||||||    
T  22415447 ttttgcctggatcgtcctttcggattttcgatccacc 22415411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 9247 - 9535
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9247 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 9346  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9347 gtacaatctcagcgagctttt-catatttgtttgttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 9445  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||||||||| ||||||||    
T  9446 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttttaggcaaagtatttcttgactatatcggcattcac 9535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 8656 - 8734
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  8656 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 8734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 8590 - 8631
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  8590 atttttgcctggatcgccctttcgggttttcgacccaccggg 8631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 118)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 310
Target Start/End: Complemental strand, 1906200 - 1905910
Alignment:
Q  17 tgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||    
T  1906200 tgccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggtttttggctcatcgagacgctcattcttgcctgagttg 1906101  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    |||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||    
T  1906100 cgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcaatccaccgggaagcgcattt 1906004  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  1906003 ttgcctaggccgccctttcgggtttttgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 1905910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 20332742 - 20333028
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  20332742 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgatttgc 20332841  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20332842 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20332938  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  20332939 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 20333028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 30759710 - 30759422
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  30759710 gccagatatagttacttgccttttgtttcaatctcatttttgtatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 30759611  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  30759610 ttacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 30759512  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  30759511 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 30759422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 33668120 - 33668408
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||     
T  33668120 gccagatatagttccttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcatttttgcctgagttgt 33668219  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||         ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  33668220 ttacaatctcagcgagctttt-catatttgtttttttttggtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 33668318  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  33668319 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 33668408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 54839338 - 54839053
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  54839338 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 54839239  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  54839238 gtacaatctcagcgagctttttcatatatatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 54839143  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  54839142 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 54839053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5700486 - 5700197
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcgg-ctcatcgagacgctcattcttgcctgagttg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  5700486 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggtctcatcgagacgctcattcttgcctgagttg 5700387  T
Q  117 cgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    |||||||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  5700386 cgtacaatctcagcgagctttt-catatttgtttgttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 5700288  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||||||||| ||||||||    
T  5700287 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttttaggcaaagtatttcttgactatatcggcattcac 5700197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 40099959 - 40100244
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  40099959 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 40100058  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  40100059 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 40100157  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| |||||||||||||||||    
T  40100158 ctaggccgccctttcgggttttcgacctaccacgctgttctttgcatatttctaggcaaagtatttcttaactatatcagcattcac 40100244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 6575808 - 6575520
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  6575808 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 6575709  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  6575708 gtacaatctcagcgagctttt-catatatattttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 6575610  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  6575609 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 6575520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 21975647 - 21975363
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  21975647 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 21975548  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  21975547 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 21975453  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  21975452 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 21975363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 17018998 - 17018708
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  17018998 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 17018899  T
Q  118 gtacaatctcagcgagctttttcatatt-tgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
     | ||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  17018898 atgcaatctcagcgagctttttcatattattatttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 17018799  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  17018798 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 17018708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 14753812 - 14754099
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||     
T  14753812 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacactcattcttgcctgagttgt 14753911  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  14753912 gttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 14754009  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  14754010 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 14754099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 24586681 - 24586968
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||    
T  24586681 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggtttttggctcatcgagacactcattcttgcctgagttgc 24586780  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    |||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24586781 gtacaatctcagcgagctttttcaaatatttttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 24586878  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  24586879 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 24586968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 15233763 - 15233475
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |    
T  15233763 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttac 15233664  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||| |||           |||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||    
T  15233663 gtacaatctcagcgagctttt-cattttttttttttgt--gtcccttatttt-gcctggaccgccctttcgggttttcgatccgccgggaagcgcatttt 15233568  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  15233567 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 15233475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 5011823 - 5011537
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  5011823 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 5011724  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5011723 gtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5011627  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||| |||||||||||||||||||| ||||||||    
T  5011626 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttctcatttctaggcaaagtatttcttgactatatcggcattcac 5011537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 14670962 - 14670675
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  14670962 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 14670863  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||    
T  14670862 gtacaatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcaggttttcgatccaccgggaagcgcatttt 14670765  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  14670764 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 14670675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 36338837 - 36339124
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  36338837 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 36338936  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || || ||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  36338937 gtgcactctcagcgagctttttcatatatatatttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 36339034  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  36339035 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 36339124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 39856583 - 39856299
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||     
T  39856583 gccagatacagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcggctcatcgagacgctcattcttgcctgagttgt 39856484  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  39856483 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 39856389  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  39856388 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 39856299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 31120833 - 31121116
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  31120833 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 31120932  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31120933 ttacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31121029  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcatt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||    
T  31121030 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcatt 31121116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 14104490 - 14104205
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||| |||||||||||||    
T  14104490 gccagatatagttacttgccttttgcttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcatttttgcctgagttgc 14104391  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    | ||||||||||||||||| ||||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  14104390 gaacaatctcagcgagcttcttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 14104295  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  14104294 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 14104205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18794936 - 18795221
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  18794936 gccagatatagttacttgccttttgtttcaatctcatttttgcctgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 18795035  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18795036 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttgtttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18795131  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18795132 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18795221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 18311498 - 18311785
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  18311498 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 18311597  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  18311598 gtacaatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 18311695  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18311696 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18311785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 43 - 310
Target Start/End: Original strand, 15276976 - 15277237
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcat 142  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15276976 tttcaatctcatttttgcatgaaccgccctttcgggttttcggcccatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcat 15277075  T
Q  143 atttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 242  Q
    |||||          ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||    
T  15277076 atttgttttt-----gtcccttattttt-cctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgccaaggccaccctttcgggtttt 15277169  T
Q  243 cgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  15277170 cgaccttccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 15277237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 307
Target Start/End: Complemental strand, 24118602 - 24118324
Alignment:
Q  24 tatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaa 123  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||    
T  24118602 tatagttacttgcctttcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgcgtgcaa 24118503  T
Q  124 tctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct 222  Q
    |||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||    
T  24118502 tctcagcgagcttttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagtgcatatttgcct 24118409  T
Q  223 aggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  24118408 aggccgccctttcgggttttcgacctatcacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 24118324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 27157634 - 27157924
Alignment:
Q  18 gccagatatagttacttgcctttt-gtttcaatctcattttt-gcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagtt 115  Q
    |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27157634 gccagatatagttacttgcctttttgtttcaatctcattttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagtt 27157733  T
Q  116 gcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttattttt-gcctggatcgcccttt-cgggttttcgatccaccgggaagcgca 213  Q
    |||| |||||||||||||||||||||||| |           ||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||    
T  27157734 gcgtgcaatctcagcgagctttttcatatatatttttt----gtcccttattttttgcctggaccgcccttttcgggttttcgatccaccgggaagcgca 27157829  T
Q  214 tttt-tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27157830 ttttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27157924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 34183281 - 34183565
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  34183281 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 34183380  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||| ||||||||| ||||| |           ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
T  34183381 atacaatctcaacgagctttt-catatatatttttt----gtcccttatttttgcatggaccgccctttcgggttttcgatccaccgggaagcgcatttt 34183475  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  34183476 tgcctaggccgccctctcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 34183565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 43 - 310
Target Start/End: Original strand, 15380582 - 15380853
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-ca 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  15380582 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttca 15380681  T
Q  142 tatttgnnnnnnnnng----gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgg 237  Q
    ||||||              |||||||||||| ||| ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||    
T  15380682 tatttgttttttttttttttgtcccttatttt-gccaggatcgccctttcgggttttcgacccaccgggaagcgcgtttttgccaaggccgccctttcgg 15380780  T
Q  238 gttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||| ||||||||||||||||||| |||||| | ||| |||||||||||||||| |||||||||||    
T  15380781 gttttcgaccttccacgctgttcttttcatacatctagacaaagaatttcttgactatatcggcattcacagg 15380853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 19770119 - 19769974
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  19770119 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 19770020  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  19770019 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 19769974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 14723288 - 14723433
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt-tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || |||| || |  || ||||||||||| |||||||||||||||  ||||||||||    
T  14723288 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcattcttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 14723387  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  14723388 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 14723433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 33184121 - 33184035
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| || ||||||||||||||  |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  33184121 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccctttcgggttttcgac 33184035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 1878924 - 1879004
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc-atttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| ||||||||||||||||| ||||||||||| || |  |||||||||| ||||||||||||||||||||||    
T  1878924 ttttgcctggaccgccctttcgggttttcaatccaccgggatgctctttttttgcctaagccgccctttcgggttttcgac 1879004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 264
Target Start/End: Original strand, 1879594 - 1879694
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  1879594 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 1879693  T
Q  264 t 264  Q
    |    
T  1879694 t 1879694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 310
Target Start/End: Original strand, 22144057 - 22144203
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-- 264  Q
    |||||| |||| |||| |||||||||||| ||||| || || || | ||||||  |||| |||||||||||||||||||||||||  ||| |||||||      
T  22144057 ttttgcatggaccgccttttcgggttttcaatccatcgagacgctcttttttgtttaggacgccctttcgggttttcgacctaccgagctattcttttac 22144156  T
Q  265 -catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
      |||||||||| | |||||||||||||||  ||||| |||||||||    
T  22144157 atatatatctagacaaagtatttcttgactgcatcagaattcacagg 22144203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 26215272 - 26215352
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| ||||||||||||||||||||||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  26215272 ttttgcctggaccgccctttcgggttttcgatccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 26215352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 55791643 - 55791726
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||| || |||| |||||||    
T  55791643 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttgcctaagccaccttttcaggttttc 55791726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 262
Target Start/End: Complemental strand, 12517633 - 12517536
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 262  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||| |||||||||||||||||| ||||  |||||||||    
T  12517633 attttttcctggaccgccctttcgggttttcattccaccgagacgctcattttttcctaagccaccctttcgggttttcgacttaccgagctgttctt 12517536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 8097806 - 8097893
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  8097806 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 8097893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 20558859 - 20558776
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  20558859 ccctaatttttgcctggaccgccctttcgggttttcagtccacctggacgctcatttttgcctaagccgccttttcaggttttc 20558776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 39857173 - 39857095
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  39857173 atttttgcctggactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 39857095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 3384854 - 3384935
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||| |||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  3384854 atttttgcctggaccgcccattcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 3384935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 6576459 - 6576418
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6576459 atttttgcctggatcgccctttcgggttttcgatccaccggg 6576418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 14105146 - 14105105
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14105146 atttttgcctggatcgccctttcgggttttcgatccaccggg 14105105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 14671617 - 14671576
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14671617 atttttgcctggatcgccctttcgggttttcgatccaccggg 14671576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 14753155 - 14753196
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14753155 atttttgcctggatcgccctttcgggttttcgatccaccggg 14753196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 14753221 - 14753302
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  14753221 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 14753302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 15234424 - 15234383
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15234424 atttttgcctggatcgccctttcgggttttcgatccaccggg 15234383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15276290 - 15276331
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15276290 atttttgcctggatcgccctttcgggttttcgatccaccggg 15276331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15379899 - 15379940
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15379899 atttttgcctggatcgccctttcgggttttcgatccaccggg 15379940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 17019653 - 17019612
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17019653 atttttgcctggatcgccctttcgggttttcgatccaccggg 17019612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18794281 - 18794322
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18794281 atttttgcctggatcgccctttcgggttttcgatccaccggg 18794322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 21976308 - 21976267
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  21976308 atttttgcctggatcgccctttcgggttttcgatccaccggg 21976267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24119266 - 24119225
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24119266 atttttgcctggatcgccctttcgggttttcgatccaccggg 24119225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 30760366 - 30760325
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30760366 atttttgcctggatcgccctttcgggttttcgatccaccggg 30760325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31120171 - 31120212
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31120171 atttttgcctggatcgccctttcgggttttcgatccaccggg 31120212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 31120237 - 31120318
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  31120237 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 31120318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 33667464 - 33667505
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33667464 atttttgcctggatcgccctttcgggttttcgatccaccggg 33667505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 34182625 - 34182666
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34182625 atttttgcctggatcgccctttcgggttttcgatccaccggg 34182666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 36323977 - 36324018
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  36323977 atttttgcctggatcgccctttcgggttttcgatccaccggg 36324018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 36338186 - 36338227
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  36338186 atttttgcctggatcgccctttcgggttttcgatccaccggg 36338227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 40099297 - 40099338
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40099297 atttttgcctggatcgccctttcgggttttcgatccaccggg 40099338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 54839995 - 54839954
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  54839995 atttttgcctggatcgccctttcgggttttcgatccaccggg 54839954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 1674465 - 1674422
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||||||||||||| |||||||||||||||||||||||||    
T  1674465 atttttgcctggatcgccttttcgggttttcgatccaccgggaa 1674422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 1906864 - 1906821
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||| |||||||||||||||||||||||||||||||||||    
T  1906864 atttttgcttggatcgccctttcgggttttcgatccaccgggaa 1906821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 3830507 - 3830577
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||| | ||||||    
T  3830507 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcccaagccgcc 3830577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 5701078 - 5701000
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  5701078 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 5701000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27157039 - 27157117
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  27157039 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 27157117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 30760300 - 30760222
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  30760300 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 30760222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 33667530 - 33667608
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33667530 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33667608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 3361469 - 3361388
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  |||| || || || |||||||||||| |||||| |||| ||||| ||||    
T  3361469 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3361388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5012482 - 5012441
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  5012482 atttttgcctggatcgccctttcgggttttcaatccaccggg 5012441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 5701144 - 5701103
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  5701144 atttttgcctggatcgccctttcgggttttcgacccaccggg 5701103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 15895497 - 15895578
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15895497 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15895578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 21976242 - 21976161
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||| |||||||||    
T  21976242 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgagttttcgac 21976161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27156973 - 27157014
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  27156973 atttttgcctggatcgccctttcgggttttcggtccaccggg 27157014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 39857239 - 39857198
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  39857239 atttttgcctggatcgccctttcgggttttcgacccaccggg 39857198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 262
Target Start/End: Complemental strand, 55786914 - 55786813
Alignment:
Q  162 cttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttc 260  Q
    ||||||||||||||   |||||||||||||||||   |||||| || || ||||||| |||| ||||||| ||||||||||||||| ||||  |||||||    
T  55786914 cttatttttgcctgagccgccctttcgggttttcagcccaccgagacgctcattttttcctaagccgcccttttcgggttttcgacttaccgagctgttc 55786815  T
Q  261 tt 262  Q
    ||    
T  55786814 tt 55786813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 9189274 - 9189190
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 243  Q
    |||| |||||||| |||| ||||||||||||||||| ||||||||||| || || ||||| |||| |||||| |||| |||||||    
T  9189274 ccctaatttttgcttggaccgccctttcgggttttcaatccaccgggacgctcattttttacctaagccgccttttcaggttttc 9189190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 251
Target Start/End: Original strand, 15570124 - 15570208
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 251  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  15570124 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 15570208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 251
Target Start/End: Original strand, 15574252 - 15574336
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 251  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  15574252 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 15574336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 17019572 - 17019509
Alignment:
Q  180 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  17019572 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 17019509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 19770752 - 19770709
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  19770752 ccctaatttttacctggatcgccctttcgggttttcgatccacc 19770709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 20558138 - 20558059
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  20558138 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 20558059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 240
Target Start/End: Original strand, 36324044 - 36324119
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 240  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||||| ||||||||||||||    
T  36324044 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggtcgccctttcgggtt 36324119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 240
Target Start/End: Original strand, 36338253 - 36338328
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 240  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||||| ||||||||||||||    
T  36338253 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggtcgccctttcgggtt 36338328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 39531675 - 39531596
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  ||||||| || || ||||||||||||  ||||| |||| ||||| ||||    
T  39531675 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaaaccgccttttcaggtttgcgac 39531596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 246
Target Start/End: Complemental strand, 5012401 - 5012335
Alignment:
Q  180 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  5012401 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 5012335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 6576393 - 6576315
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  6576393 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgcccttccgggttttc 6576315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 14105080 - 14105002
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  14105080 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 14105002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 14671551 - 14671473
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  14671551 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 14671473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 310
Target Start/End: Original strand, 17296937 - 17297035
Alignment:
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||| | |||||||||||| |||||| ||||||  |||||||||||  |||| ||||| | ||||||| ||||||  |||||| |||||||||    
T  17296937 atttttgcctggaccgccctttcggattttcggcctaccgagctgttcttttatatatgtctagacaaagtattgcttgaccgtatcagaattcacagg 17297035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 24119200 - 24119122
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24119200 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24119122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 34182691 - 34182769
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34182691 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34182769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 40099363 - 40099441
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  40099363 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 40099441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 3361469 - 3361412
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  |||||||||||||||| ||||||    
T  3361469 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgcct 3361412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 3362166 - 3362109
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  |||||||||||||||| ||||||    
T  3362166 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgcct 3362109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 3362863 - 3362806
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  |||||||||||||||| ||||||    
T  3362863 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgcct 3362806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 3363629 - 3363588
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||| |||||||||||||||||||| ||||||||||||    
T  3363629 ttttgcctagatcgccctttcgggttttcaatccaccgggaa 3363588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 8097745 - 8097786
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  8097745 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 8097786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 243
Target Start/End: Complemental strand, 22709784 - 22709719
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||||||| |||||||||| || || |||||||||| |||||| |||| |||||||    
T  22709784 cgccctttcgggttttcggtccaccgggacgctcattttttgcctaagccgccttttcaggttttc 22709719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 14722583 - 14722623
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||||||||||||| |||||||| |||||||||||||||||    
T  14722583 ttttgcctggatcgtcctttcggattttcgatccaccggga 14722623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 16723181 - 16723245
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 229  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||    
T  16723181 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgc 16723245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 223
Target Start/End: Complemental strand, 3363566 - 3363503
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 223  Q
    |||| ||||||||||||| |||||||  ||||||||  |||||||||| || ||||||||||||    
T  3363566 ccctaatttttgcctggaccgcccttctgggttttcagtccaccgggacgctcatttttgccta 3363503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 8098581 - 8098636
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  8098581 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 8098636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 20332084 - 20332127
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | |||||||||||||||| |||||||||||||    
T  20332084 atttttgcctgaaccgccctttcgggtttttgatccaccgggaa 20332127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 24586022 - 24586065
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | ||||||||||| ||||||||||||||||||    
T  24586022 atttttgcctgaaccgccctttcggattttcgatccaccgggaa 24586065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 240
Target Start/End: Complemental strand, 54839929 - 54839854
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 240  Q
    ||||||||||| |  |||||| |||||| || ||||| ||||  || |||||||||||| ||||||||||||||||    
T  54839929 atttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggtt 54839854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 3362166 - 3362108
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 223  Q
    ||||||||||||| |||||||||||||||||  |||| || || || ||||||||||||    
T  3362166 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgccta 3362108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 3362863 - 3362805
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 223  Q
    ||||||||||||| |||||||||||||||||  |||| || || || ||||||||||||    
T  3362863 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgccta 3362805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 14722650 - 14722692
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  14722650 ccctaatttttacctggatcaccctttcgggttttcgatccac 14722692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 107
Target Start/End: Original strand, 14723288 - 14723342
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttg 107  Q
    |||||||| || ||||||||||||||||||||   || |||||||||||||||||    
T  14723288 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcattcttg 14723342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 14875078 - 14875020
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 223  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||||||||    
T  14875078 atttttccctggaccgccctttcgggttttcagtccaccgagacgctcatttttgccta 14875020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 15379965 - 15380043
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| | |||||||||||||||||    
T  15379965 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagtcgccctttcgggttttc 15380043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 55786911 - 55786861
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| ||| |||||||||||||||||| || || |||||||||||||    
T  55786911 atttttgcctgagccgccctttcgggttttcagcccaccgagacgctcatt 55786861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 230
Target Start/End: Complemental strand, 14923230 - 14923165
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    |||||||||||||   |||||||||||||||  |||||| ||| || |||||||||||| ||||||    
T  14923230 atttttgcctggacttccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgcc 14923165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 14923289 - 14923248
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  14923289 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 14923248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 15894723 - 15894764
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  15894723 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 15894764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 22709861 - 22709820
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  22709861 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 22709820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 33184183 - 33184142
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | ||||||||||||||| ||||||||||||    
T  33184183 ttttgcctggaccaccctttcgggttttcaatccaccgggaa 33184142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 12616580 - 12616620
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  12616580 ttttgcctggaccgccctttcgggttttcagtccaccggga 12616620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 150)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 3788427 - 3788141
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  3788427 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 3788328  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  3788327 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 3788231  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3788230 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3788141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 13930855 - 13931143
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||     
T  13930855 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcggctcatcgagacgctcattcttgcctgagttgt 13930954  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||         | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  13930955 gtacaatctcagcgagctttttcatatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 13931053  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  13931054 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 13931143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 34269232 - 34269516
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  34269232 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 34269331  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||    
T  34269332 caatctcagcgagctttttcatatatttttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgtatttttgc 34269429  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  34269430 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 34269516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 9344296 - 9344582
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  9344296 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 9344395  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9344396 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 9344492  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  9344493 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 9344582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 20843846 - 20843561
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||     
T  20843846 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggtttttggttcatcgagacgctcattcttgcctgagttgt 20843747  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20843746 gtacaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20843651  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  20843650 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 20843561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 32055736 - 32055451
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  32055736 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 32055637  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  32055636 gtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 32055541  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  32055540 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 32055451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 34297090 - 34296802
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  34297090 gccagatataattacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 34296991  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||| ||||||||||||||||||         | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34296990 gtgcaatctcaacgagctttttcatatttgtttttttttg-tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 34296892  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||| ||||||||    
T  34296891 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttgactatatcggcattcac 34296802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 21697484 - 21697769
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21697484 gccagatatagttacttgccttt-gtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 21697582  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||| ||||||||| |||||||           ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||    
T  21697583 gtacaatctcaacgagctttt-catattttttttt-----gtcccttatttttgcctagaccgccctttcgggttttcgatccaccgggaagcgcatttt 21697676  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  21697677 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 21697769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 37931302 - 37931017
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  37931302 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgta 37931203  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||||||          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  37931202 caatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 37931104  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  37931103 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 37931017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 12592743 - 12592456
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  12592743 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgatttgc 12592644  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| ||         | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
T  12592643 gtacaatctcagcgagctttt-catatgtgtttttttttg-tcccttatttttgcttggaccgccctttcgggttttcgatccaccgggaagcgcatttt 12592546  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  12592545 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 12592456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 12661472 - 12661185
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||     
T  12661472 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaatcgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgt 12661373  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  12661372 gtacaatctcagcgagctttttcatatatttttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 12661275  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  12661274 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 12661185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 27428755 - 27429037
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  27428755 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 27428854  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||     
T  27428855 gtacaatctcagcgagctttttcatatattttt-------gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttc 27428947  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  27428948 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 27429037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 34160777 - 34160492
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  34160777 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 34160678  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  34160677 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 34160582  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  34160581 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcagcattcac 34160492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 37383610 - 37383325
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  37383610 gccagatatagttacttgcctttggtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 37383511  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  37383510 gttcaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 37383415  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37383414 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37383325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 39896001 - 39895717
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
T  39896001 gccagatatagttacttgcctcttgtttcaatctcatttttgcatgaaccgcccctccgggttttcggctcatcgagacgctcattcttgcctgagttgc 39895902  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  39895901 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 39895807  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  39895806 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 39895717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37680202 - 37680491
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  37680202 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 37680301  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  37680302 gttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 37680400  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37680401 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37680491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37695467 - 37695756
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  37695467 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 37695566  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  37695567 gttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 37695665  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  37695666 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 37695756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27122458 - 27122172
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  27122458 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 27122359  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||||| |           |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27122358 gtgcaatctcagcgagcttttccatatatattttttt---gtcccttagttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27122262  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27122261 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27122172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27809634 - 27809351
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
T  27809634 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgcacattcttgcctgagttgt 27809535  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27809534 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27809441  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27809440 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27809351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 16167409 - 16167128
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||    
T  16167409 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtgt 16167310  T
Q  120 acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 219  Q
    ||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  16167309 acaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttg 16167216  T
Q  220 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  16167215 cctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 16167128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 21671482 - 21671771
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  21671482 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 21671581  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
T  21671582 gttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcattt 21671680  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  21671681 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 21671771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 254961 - 255249
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||  ||||||||||||||||||||||||||||||     
T  254961 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcgattcatcgagacgctcattcttgcctgagttgt 255060  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  255061 gtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 255159  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||| ||||||||    
T  255160 tgcctaggccgccctttcgggttttcgacctaccacgctgttctttttatatttctaggcaaagtatttcttgactatatcggcattcac 255249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 11629493 - 11629780
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  11629493 gccagatatagttacttgccttttgtttcaatctcattcttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 11629592  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  11629593 atgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11629690  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  11629691 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 11629780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 28888212 - 28887927
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  28888212 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 28888113  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  28888112 gtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 28888017  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  28888016 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 28887927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 31882220 - 31881934
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  31882220 gccaggtatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 31882121  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31882120 gtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31882024  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  31882023 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 31881934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 37946175 - 37946458
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
T  37946175 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcgttcttgcctgatttgc 37946274  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| |||||||           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  37946275 gtacaatctcagcgagctttt-catattttttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 37946368  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||| |||||||||||||||||||| ||||||||    
T  37946369 tgcctaggccgccctttcgggttttcgacctaccacgctattcttttcatgtttctaggcaaagtatttcttgactatatcggcattcac 37946458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 39046131 - 39046415
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  39046131 gccagatacagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggttcatcgagacgctcattcttgcctgagttgc 39046230  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||| ||||          |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
T  39046231 gtgcaatctcagcgagctttt-catttttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccaggaagcgcatttt 39046325  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  39046326 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 39046415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 22922455 - 22922744
Alignment:
Q  19 ccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcg 118  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |    
T  22922455 ccagatatagttacttgccttctgtttcaatctcattcttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtg 22922554  T
Q  119 tacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    |||||||||||||||||||| ||||||||            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  22922555 tacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 22922653  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  22922654 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 22922744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 16823649 - 16823931
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16823649 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 16823748  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16823749 ttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16823844  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcatt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||    
T  16823845 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcatt 16823931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 16897831 - 16897549
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  16897831 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 16897732  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  16897731 ttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 16897636  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcatt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||    
T  16897635 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcatt 16897549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 307
Target Start/End: Original strand, 12710914 - 12711197
Alignment:
Q  22 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtac 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||  |||    
T  12710914 gatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgtatac 12711013  T
Q  122 aatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcc 221  Q
    ||||||||||||||||| ||||||||         | ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
T  12711014 aatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatttttgcc 12711111  T
Q  222 taggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  12711112 taggccgccctttcgggttttcgacctatcacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 12711197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27782165 - 27781882
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  27782165 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 27782066  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27782065 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27781972  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27781971 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27781882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 27821922 - 27821639
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||     
T  27821922 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgt 27821823  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27821822 gtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 27821729  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  27821728 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 27821639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 34867616 - 34867332
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
T  34867616 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcgattcatcgagacgctcattcttgcctgagttgc 34867517  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  34867516 gtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 34867422  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||| ||||||||    
T  34867421 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtacttcttgactatatcggcattcac 34867332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 40239442 - 40239156
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||     
T  40239442 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgtctgagttgt 40239343  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  40239342 ttacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 40239246  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  40239245 tgcctaggccgccctttcgggttttcgacctaccgcgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 40239156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 21 - 307
Target Start/End: Original strand, 23122885 - 23123165
Alignment:
Q  21 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |     
T  23122885 agatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgcatg 23122984  T
Q  121 caatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgc 220  Q
    |||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  23122985 caatctcagcgagctttt-catatatattttt-----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgc 23123078  T
Q  221 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  23123079 ctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatgtctaggcaaagtatttcttgactatatcggcattcac 23123165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 31887802 - 31888087
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||    
T  31887802 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttctgggttttcgattcatcgagacgctcattcttgcctgagttgc 31887901  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  31887902 atacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 31887997  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  31887998 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 31888087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 43 - 310
Target Start/End: Original strand, 19450761 - 19451022
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcat 142  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  19450761 tttcaatctcatttttgcatgaaccgccctttcgggttttcggcccatcgagacgctcattcttgcctgagttgcgtacaacctcagcgagctttttcat 19450860  T
Q  143 atttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 242  Q
    |||||          |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||    
T  19450861 atttgttttt-----gtcccttatttt-gcctggatcgccctttcgggtttttgatccaccgggaagcgcatttttgccaaggcggccctttcgggtttt 19450954  T
Q  243 cgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  19450955 cgaccttccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 19451022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 43 - 274
Target Start/End: Complemental strand, 27396231 - 27396001
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt--c 140  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
T  27396231 tttcaatctcatttttgcatgaaccgccctttcggattttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttttc 27396132  T
Q  141 atatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 240  Q
    |||||||          |||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  27396131 atatttgtttttttt--gtcccttatttt-gcctggatcgcccttttgggttttcgatccaccaggaagcgcatttttgcctaggccgccctttcgggtt 27396035  T
Q  241 ttcgacctaccacgctgttcttttcatatatcta 274  Q
    |||||||| |||||||||||||||||||||||||    
T  27396034 ttcgaccttccacgctgttcttttcatatatcta 27396001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 158 - 307
Target Start/End: Original strand, 19410948 - 19411097
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 257  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19410948 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 19411047  T
Q  258 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  19411048 ttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 19411097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 19410796 - 19410916
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  19410796 gccagatatagttacttgccttttgtttcattctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgt 19410895  T
Q  118 gtacaatctcagcgagctttt 138  Q
     ||||||||||||||||||||    
T  19410896 atacaatctcagcgagctttt 19410916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 42396301 - 42396156
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  42396301 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 42396202  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  42396201 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 42396156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 34703842 - 34703697
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  34703842 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 34703743  T
Q  264 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    | |||||| ||| | |||||||||||||||  ||||  |||||||||    
T  34703742 t-atatatttagacaaagtatttcttgactgcatcaaaattcacagg 34703697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 165 - 264
Target Start/End: Original strand, 34531927 - 34532027
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  34531927 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 34532026  T
Q  264 t 264  Q
    |    
T  34532027 t 34532027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Complemental strand, 22952159 - 22952060
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  22952159 atttttgcctggaccgccctttcgggttttcagtccaccgagatgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 22952060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 26721752 - 26721899
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||||||||||| |||||||  ||||||||||    
T  26721752 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 26721851  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  26721852 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 26721899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 13930261 - 13930342
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||||||||||||||||||||||||||| |||   || |||| ||||||| ||||||||| ||||||||||||    
T  13930261 atttttgcctggatcgccctttcgggttttcgatccagcggagtgctcattcttgcctaagccgcccttccgggttttcgac 13930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 39045537 - 39045618
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||||||||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  39045537 atttttgcctggatcgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 39045618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 26721081 - 26721157
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  26721081 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 26721157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 3761100 - 3761187
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  3761100 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 3761187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 34531245 - 34531321
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||||||||||||||||||||| ||||||||||| || |  |||| |||| || ||||||||||||||||    
T  34531245 ttttgcctggatcgccctttcgggttttcaatccaccgggacgctctcttttacctaagctgccctttcgggttttc 34531321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 42569227 - 42569314
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| |||||||||||||  |||||||||||||||| ||||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  42569227 ccctaatttttgcctggactgccctttcgggttttcaatccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 42569314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 22921860 - 22921938
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22921860 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22921938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 254303 - 254344
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  254303 atttttgcctggatcgccctttcgggttttcgatccaccggg 254344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 9343638 - 9343679
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9343638 atttttgcctggatcgccctttcgggttttcgatccaccggg 9343679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12593405 - 12593364
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12593405 atttttgcctggatcgccctttcgggttttcgatccaccggg 12593364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12662082 - 12662041
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12662082 atttttgcctggatcgccctttcgggttttcgatccaccggg 12662041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 12710252 - 12710293
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12710252 atttttgcctggatcgccctttcgggttttcgatccaccggg 12710293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16168069 - 16168028
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16168069 atttttgcctggatcgccctttcgggttttcgatccaccggg 16168028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16822988 - 16823029
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16822988 atttttgcctggatcgccctttcgggttttcgatccaccggg 16823029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 16823054 - 16823135
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  16823054 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 16823135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 16898426 - 16898345
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  16898426 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 16898345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16898492 - 16898451
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16898492 atttttgcctggatcgccctttcgggttttcgatccaccggg 16898451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 19450069 - 19450110
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19450069 atttttgcctggatcgccctttcgggttttcgatccaccggg 19450110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20844505 - 20844464
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20844505 atttttgcctggatcgccctttcgggttttcgatccaccggg 20844464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22921794 - 22921835
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22921794 atttttgcctggatcgccctttcgggttttcgatccaccggg 22921835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 23122227 - 23122268
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23122227 atttttgcctggatcgccctttcgggttttcgatccaccggg 23122268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27396927 - 27396886
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27396927 atttttgcctggatcgccctttcgggttttcgatccaccggg 27396886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27782821 - 27782780
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27782821 atttttgcctggatcgccctttcgggttttcgatccaccggg 27782780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27810294 - 27810253
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27810294 atttttgcctggatcgccctttcgggttttcgatccaccggg 27810253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 31868437 - 31868478
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31868437 atttttgcctggatcgccctttcgggttttcgatccaccggg 31868478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 32056344 - 32056303
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  32056344 atttttgcctggatcgccctttcgggttttcgatccaccggg 32056303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 34161437 - 34161396
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34161437 atttttgcctggatcgccctttcgggttttcgatccaccggg 34161396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 34868225 - 34868184
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34868225 atttttgcctggatcgccctttcgggttttcgatccaccggg 34868184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37945516 - 37945557
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  37945516 atttttgcctggatcgccctttcgggttttcgatccaccggg 37945557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 40240099 - 40240058
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40240099 atttttgcctggatcgccctttcgggttttcgatccaccggg 40240058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 21854655 - 21854742
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||| ||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  21854655 ccctaatttttgtctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 21854742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 28888843 - 28888804
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  28888843 ttttgcctggatcgccctttcgggttttcgatccaccggg 28888804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 35144103 - 35144016
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  35144103 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 35144016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 11628902 - 11628980
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11628902 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11628980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 12593339 - 12593261
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  12593339 atttttgcctggactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 12593261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16168003 - 16167925
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| |||||||||||||||||||    
T  16168003 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgccctttcgggttttc 16167925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19410201 - 19410279
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  19410201 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 19410279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 23122293 - 23122371
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  23122293 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 23122371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 24290582 - 24290500
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcga-tccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||||||| | ||||  | |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  24290582 atttttgcctggaccgccctttcagttttttcagtccaccaggacgctcatttttgcctaagccgccctttcgggttttcgac 24290500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27123048 - 27122970
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27123048 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27122970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 37384202 - 37384124
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  37384202 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 37384124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 37931904 - 37931826
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  37931904 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 37931826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 40240033 - 40239955
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  40240033 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 40239955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 12387082 - 12387033
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||| |||||||||||    
T  12387082 tccctaatttttgcctggaccgccctttcgggttttcggtccaccgggaa 12387033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 19410135 - 19410176
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  19410135 atttttgcctggatcgccctttcgggttttcggtccaccggg 19410176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 23117388 - 23117347
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||| ||||||||||||||||||||||||||||||||||||    
T  23117388 attttcgcctggatcgccctttcgggttttcgatccaccggg 23117347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 27123114 - 27123073
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  27123114 atttttgcctggatcgccctttcgggttttcgacccaccggg 27123073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27428104 - 27428145
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  27428104 atttttgcttggatcgccctttcgggttttcgatccaccggg 27428145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31882877 - 31882836
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  31882877 atttttgcctggatcgccctttcgggttttcggtccaccggg 31882836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 206
Target Start/End: Original strand, 34268581 - 34268618
Alignment:
Q  169 ttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||    
T  34268581 ttgcctggatcgccctttcgggttttcgatccaccggg 34268618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 34297740 - 34297699
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  34297740 atttttgcctagatcgccctttcgggttttcgatccaccggg 34297699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 37384268 - 37384227
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  37384268 atttttgcctggatcgccctttcgggttttcgacccaccggg 37384227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37679542 - 37679583
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  37679542 atttttgcctggatcgccctctcgggttttcgatccaccggg 37679583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37694807 - 37694848
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  37694807 atttttgcctggatcgccctctcgggttttcgatccaccggg 37694848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 37931970 - 37931929
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  37931970 atttttgcctggatcgccctttcgggttttcggtccaccggg 37931929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 39896659 - 39896618
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  39896659 atttttgcctggatcgccctttcgggttttcgatccatcggg 39896618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 21670821 - 21670861
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||| |||||||||||||||||||||||||||    
T  21670821 tttttgcctggattgccctttcgggttttcgatccaccggg 21670861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 16278979 - 16278892
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||| ||||| |||||||||||||||||  |||| ||||| || ||||||| || ||  |||||||||||||||||||||    
T  16278979 ccctaatttttgtctggaccgccctttcgggttttcagtccatcgggacgctcatttttggcttaaaccgccctttcgggttttcgac 16278892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 243
Target Start/End: Complemental strand, 31882808 - 31882733
Alignment:
Q  168 tttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  31882808 tttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 31882733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 254369 - 254447
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  254369 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 254447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 12710318 - 12710396
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12710318 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12710396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19450135 - 19450213
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| | ||| |||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  19450135 atttttgcctgaaccgctctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 19450213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 23117321 - 23117243
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  23117321 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 23117243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 25500161 - 25500111
Alignment:
Q  158 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  25500161 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 25500111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 27428170 - 27428248
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27428170 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27428248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27810228 - 27810150
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  27810228 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 27810150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 28888779 - 28888701
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  28888779 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 28888701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 34161371 - 34161293
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34161371 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34161293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 34268643 - 34268721
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34268643 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34268721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 37945582 - 37945660
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  37945582 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 37945660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 39896593 - 39896515
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  39896593 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 39896515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 3761036 - 3761077
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  3761036 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 3761077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 3789036 - 3788995
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||| ||||||||||||||||||||||||| |||||||||    
T  3789036 attttttcctggatcgccctttcgggttttcggtccaccggg 3788995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 11628836 - 11628877
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  11628836 atttttgcttggatcgccctttcgggttttcgacccaccggg 11628877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 15947690 - 15947731
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  15947690 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 15947731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 21696837 - 21696878
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| ||||||||||||||||||||| |||||||||||    
T  21696837 atttttgcttggatcgccctttcgggtttttgatccaccggg 21696878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 42569166 - 42569207
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  42569166 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 42569207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 20277448 - 20277512
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 229  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||    
T  20277448 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttgcctaagccgc 20277512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 21670886 - 21670962
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 241  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  21670886 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 21670962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 21753149 - 21753233
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||| | || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  21753149 cgccctttcgggttttcagcccactgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 21753233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 37679608 - 37679684
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 241  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  37679608 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 37679684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 37694873 - 37694949
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 241  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  37694873 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 37694949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 12386955 - 12386908
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  12386955 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 12386908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 12387018 - 12386971
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  12387018 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 12386971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 15947752 - 15947838
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || ||||||| || | |||||||| |||||||||||    
T  15947752 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttgcttaag-cgccctttagggttttcgac 15947838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 15948523 - 15948578
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  15948523 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 15948578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 21117737 - 21117682
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||||||||||||||||||||||| |  ||||||||| ||| || ||||||    
T  21117737 ttttgcatgaaccgccctttcgggttttcagtccatcgagacactcttttttgcct 21117682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 25500086 - 25499999
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||| |||||||||||||  |||| || || || ||||||| || || ||| ||||||||||||||||||    
T  25500086 ccctaatttttgcctggaccgctctttcgggttttcagtccaacgagacgctcatttttggcttaagccaccctttcgggttttcgac 25499999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 35143316 - 35143261
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  35143316 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 35143261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 42396933 - 42396890
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccacc 203  Q
    |||| |||||| |||||| |||||||||||||||||||||||||    
T  42396933 ccctaatttttacctggaccgccctttcgggttttcgatccacc 42396890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 42569999 - 42570054
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  42569999 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 42570054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 3760078 - 3760120
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  3760078 ccctaatttttacctggaccgccctttcgggttttcgatccac 3760120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 20844439 - 20844361
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||| |||||||| || |||||  |||  || |||||||||||| |||||||||||||||||||    
T  20844439 atttttgcctgaactgccccttcgggttgtcaatccagtggggtgctcatttttgcctaagccgccctttcgggttttc 20844361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 21696903 - 21696981
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || |||||  |||  || |||||||||||| | |||||||||||||||||    
T  21696903 atttttgcctgaactgccctttcgggttgtcaatccagtggggtgctcatttttgcctaagtcgccctttcgggttttc 21696981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 21758096 - 21758146
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| ||| |||||||||||||||||| || || |||||||||||||    
T  21758096 atttttgcttgagccgccctttcgggttttcagcccaccgagacgctcatt 21758146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 235
Target Start/End: Complemental strand, 24694182 - 24694112
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 235  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||| ||| |||||| ||||    
T  24694182 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgtctaagccgccttttc 24694112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 27396861 - 27396783
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||| ||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  27396861 atttttgcctgaactgcccttttgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 27396783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 16279043 - 16279002
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  16279043 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 16279002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 20616287 - 20616246
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||| |||||||||||| ||||||||||||    
T  20616287 ttttgcctggaccgccgtttcgggttttcaatccaccgggaa 20616246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 21753135 - 21753192
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| ||| |||||||||||||||||| || ||  |||||||||||| ||||||    
T  21753135 atttttgcttgagccgccctttcgggttttcagcccactgagacgctcatttttgcct 21753192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Complemental strand, 24289831 - 24289786
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctc 100  Q
    ||||||||| ||||||||||||||||||| |  |||||||||||||    
T  24289831 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctc 24289786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 24290647 - 24290606
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| | ||||||||||||||| ||||||||||||    
T  24290647 ttttgcctggacctccctttcgggttttcaatccaccgggaa 24290606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 20615429 - 20615361
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 235  Q
    |||||| ||||||||||||||||||||||  |||| || || || | |||||||||| |||||| ||||    
T  20615429 ttttgcatggatcgccctttcgggttttcagtccatcgagacgctcttttttgcctaagccgccttttc 20615361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 21758110 - 21758193
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 262  Q
    |||||||||||||||||   |||||| || || |||||| ||||| |||||||||| |||||||||||| ||||  |||||||||    
T  21758110 cgccctttcgggttttcagcccaccgagacgctcatttt-gcctaagccgcccttttcgggttttcgacttaccgagctgttctt 21758193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 223; Significance: 1e-123; HSPs: 7)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 33232 - 32939
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  33232 gccagatatagttacttgccttttgtttcaatctcatttttgcatggaccgccctttcgggttttcggttcatcgagacgctcattcttgcctgagttgc 33133  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtccctt-atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattt 216  Q
    ||||||||||||||||||||||||||| |           ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  33132 gtacaatctcagcgagctttttcatatattatttttttttgtccctttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattt 33033  T
Q  217 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||    
T  33032 ttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcacagg 32939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 9849 - 9671
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  9849 gccagatatagttacttgcctttcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 9750  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcga 197  Q
    ||||||||||||||||| ||||||||| |           |||||||||||||||||||| |||||||||||||||||||    
T  9749 gtacaatctcagcgagc-ttttcatatattatttctttttgtcccttatttttgcctggaccgccctttcgggttttcga 9671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #3
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 213 - 307
Target Start/End: Complemental strand, 9703 - 9609
Alignment:
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||| | ||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  9703 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 9609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33888 - 33847
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  33888 atttttgcctggatcgccctttcgggtttccgatccaccggg 33847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 10506 - 10466
Alignment:
Q  166 tttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||| |||||||||||||||||||||||||    
T  10506 tttttgcctggatcgtcctttcgggttttcgatccaccggg 10466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 10441 - 10363
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  10441 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 10363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 33822 - 33744
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  33822 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttc 33744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 13884 - 13598
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  13884 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 13785  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  13784 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 13688  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  13687 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 13598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 14543 - 14502
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14543 atttttgcctggatcgccctttcgggttttcgatccaccggg 14502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 14477 - 14399
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  14477 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 14399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: scaffold0418
Description:

Target: scaffold0418; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 11973 - 11685
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  11973 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgc 11874  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  11873 atacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 11775  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  11774 tgcctaagccgccctctcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 11685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12628 - 12587
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12628 atttttgcctggatcgccctttcgggttttcgatccaccggg 12587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 12562 - 12484
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12562 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 15504 - 15220
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  15504 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 15405  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  15404 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 15310  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||    
T  15309 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttgactatatcggcattcac 15220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 16103 - 16025
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  16103 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 16025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16169 - 16128
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  16169 atttttgcctggatcgccctttcgggttttcgacccaccggg 16128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322 (Bit Score: 219; Significance: 1e-120; HSPs: 6)
Name: scaffold0322
Description:

Target: scaffold0322; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 1592 - 1307
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  1592 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggttcatcgagacgctcattcttgcctgagttgc 1493  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  1492 gtgcaatctcagcgagctttt-catttttgttttttt---gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 1397  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  1396 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 1307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 11982 - 11691
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||     
T  11982 gccagatatagttacttgtcttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggcccatcgagacgctcattcttgtctgagttgt 11883  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||||||||||||          |||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||    
T  11882 gtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttt-gcctggaccgccctttcgggttttcgatccaccgagaagcgcatttt 11784  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||  ||||||||||    
T  11783 tgcctaggccgccctttcgggttttcgacctagcacgctgttcttttcatatatataggcaaagtatttcttgactatatcgacattcacagg 11691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 2184 - 2103
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  2184 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2250 - 2209
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  2250 atttttgcttggatcgccctttcgggttttcgatccaccggg 2209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 12571 - 12493
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |   |||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  12571 atttttgcctgaactaccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 12493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12637 - 12596
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||| |||||||||||||| || |||||||||||||||    
T  12637 atttttgcttggatcgccctttcaggctttcgatccaccggg 12596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 312 - 28
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
T  312 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcatcgagacgctcattcttgcctgagttgc 213  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  212 gtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 118  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  117 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 28  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 219; Significance: 1e-120; HSPs: 6)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 3500 - 3786
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  3500 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 3599  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
T  3600 gtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaaacgcatttt 3696  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3697 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 168 - 307
Target Start/End: Original strand, 13263 - 13402
Alignment:
Q  168 tttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcat 267  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13263 tttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcat 13362  T
Q  268 atatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    || ||||||| |||||||||||||||||||| ||||||||    
T  13363 atttctaggcaaagtatttcttgactatatcggcattcac 13402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 2840 - 2881
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2840 atttttgcctggatcgccctttcgggttttcgatccaccggg 2881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 18401 - 18360
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18401 atttttgcctggatcgccctttcgggttttcgatccaccggg 18360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 2906 - 2984
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  2906 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 2984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 18335 - 18257
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  18335 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 18257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 6001 - 5716
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||    
T  6001 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttccgggttttcggttcattgagacgctcattcttgcctgagttgc 5902  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    || |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5901 gtgcaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 5806  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5805 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 6656 - 6615
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  6656 atttttgcctagatcgccctttcgggttttcgatccaccggg 6615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 6590 - 6512
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  6590 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 6512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 18518 - 18231
Alignment:
Q  20 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||    
T  18518 cagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgcccttcagggttttcggctcatcgagacgctcattcttgcctgagttgtgt 18419  T
Q  120 acaatctcagcgagctttttcatattt-gnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    ||||||||||||||||||| ||||||| |          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  18418 acaatctcagcgagctttt-catattttgttttttttttgtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcattttt 18320  T
Q  219 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  18319 gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 18231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: scaffold0240
Description:

Target: scaffold0240; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 25221 - 25506
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||    
T  25221 gccagatatagttacttgcctttcgtttctatctcatttttgcatgaaccgcccttccgagttttcggctcatcgagacactcattcttgcctgagttgc 25320  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
     | ||||||||||||||||||||||||||          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  25321 atgcaatctcagcgagctttttcatattt----ttttttgttcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 25416  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||| ||||||||||| |||||||| ||||||||    
T  25417 tgcctaggccgccctttcgggttttcgacctaccacactgttcttttcacatttctaggcaaagtatttctttactatatcggcattcac 25506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 24615 - 24656
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24615 atttttgcctggatcgccctttcgggttttcgatccaccggg 24656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0792 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: scaffold0792
Description:

Target: scaffold0792; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 4925 - 5213
Alignment:
Q  18 gccagatatagttacttgcctttt-gtttcaatctcatttttgcatgaaccgccctttc-gggttttcggctcatcgagacgctcattcttgcctgagtt 115  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||    
T  4925 gccagacatagttacttgcctttttgtttcaatctcatttttgcatgaaccgcccttcccgggttttcggttcatcgagacgctcattcttgcctgagtt 5024  T
Q  116 gcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtccctt-atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcat 214  Q
    | |||||||||||||||||||| | |||||           | |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  5025 gtgtacaatctcagcgagctttat-atatt---atttttttgttccctttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcat 5120  T
Q  215 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  5121 ttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 5213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0792; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 4262 - 4304
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttc-gatccaccggg 206  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
T  4262 atttttgcctggatcgccctttcgggttttcggatccaccggg 4304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 20512 - 20798
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    |||| |||||||||||||||| | || ||||||||| ||| |||||| || ||||| |||||||||||||||||||||||||||||||| ||||||| ||    
T  20512 gccaaatatagttacttgcctgtggtgtcaatctcaatttggcatgacccccccttccgggttttcggctcatcgagacgctcattctttcctgagtcgc 20611  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttt 217  Q
    ||||||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  20612 gtacaatctcagcgagctttt-catttttgtttttttt--gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttt 20708  T
Q  218 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  20709 tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 20798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 9174 - 9089
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcg 244  Q
    |||| ||||||||||||| | |||||||||||||| ||||||||  |  || || ||||||| || ||||||| ||||||||||||    
T  9174 ccctaatttttgcctggaccaccctttcgggtttttgatccaccaaggtgctcattttttgcttaagccgcccattcgggttttcg 9089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 43 - 310
Target Start/End: Complemental strand, 25025 - 24762
Alignment:
Q  43 tttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-ca 141  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  25025 tttcaatctcattttagc-tgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttca 24927  T
Q  142 tatttgnnnnnnnnnggtcccttatttttgcctggatcgccc-tttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 240  Q
    ||||||          ||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||| ||| ||||| | ||||||||||    
T  24926 tatttgtttttt----gtcccttattttt-cctagatcgcccctttcgggttttcgatccaccgggaagcgcattttggccaaggcctcactttcgggtt 24832  T
Q  241 ttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||||| |||||||||||||||||||||||||| | ||| |||||||||||||||| |||||||||||    
T  24831 ttcgaccttccacgctgttcttttcatatatctagacaaagaatttcttgactatatcggcattcacagg 24762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 25715 - 25674
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    |||||||||||||||||||||||||||||| |||||||||||    
T  25715 atttttgcctggatcgccctttcgggtttttgatccaccggg 25674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 25649 - 25571
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||| ||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25649 atttttgcctgaactgcccttttgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 51 - 307
Target Start/End: Complemental strand, 11934 - 11672
Alignment:
Q  51 tcatttttg-catgaaccgccctttcgggttttcgg-ctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgn 148  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||     
T  11934 tcatttttgtcatgaaccgccctttcgggttttcggtctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttcattatttgt 11835  T
Q  149 nnnnnnnng---gtcccttattttt-gcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcg 244  Q
                ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11834 tttgttttttttgtcccttattttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcg 11735  T
Q  245 acctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||||||||||||||| || | ||||| |||||||||||||||||||| ||||||||    
T  11734 acctaccacgctgttcttttcacatttttaggcaaagtatttcttgactatatcggcattcac 11672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: scaffold0242
Description:

Target: scaffold0242; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 86 - 310
Target Start/End: Complemental strand, 351 - 130
Alignment:
Q  86 ctcatcgagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccct 184  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||| ||||||| ||||||    
T  351 ctcatcaagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcatatattttttttt---gtcccttatttt-gcctggaccgccct 256  T
Q  185 ttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtat 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  255 ttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtat 156  T
Q  285 ttcttgactatatcagcattcacagg 310  Q
    |||||||||||||||| |||||||||    
T  155 ttcttgactatatcagtattcacagg 130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547 (Bit Score: 113; Significance: 3e-57; HSPs: 4)
Name: scaffold0547
Description:

Target: scaffold0547; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 9959 - 10135
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctcatttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcctgagttgc 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
T  9959 gccagatatagttacttgcctttcgtttcaatctcatttttgcatgaaccgcccttccgggttttcggctcatcgagacgctcattcttgcctgagttgt 10058  T
Q  118 gtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcga 197  Q
    ||||||||||||||||| ||||||||| |           |||||||||||||||||||| |||||||||||||||||||    
T  10059 gtacaatctcagcgagc-ttttcatatat--attttttttgtcccttatttttgcctggaccgccctttcgggttttcga 10135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 213 - 307
Target Start/End: Original strand, 10103 - 10197
Alignment:
Q  213 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10103 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 9303 - 9344
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9303 atttttgcctggatcgccctttcgggttttcgatccaccggg 9344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 9369 - 9447
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  9369 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 9447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: scaffold0404
Description:

Target: scaffold0404; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 167 - 310
Target Start/End: Complemental strand, 12983 - 12840
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttc 265  Q
    ||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  |||||||||||     
T  12983 ttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttctttt- 12885  T
Q  266 atatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  12884 atatatttagacaaagtatttcttgactgcatcagaattcacagg 12840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 13625 - 13583
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  13625 ccctaatttttacctggaccgccctttcgggttttcgatccac 13583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 13783 - 13741
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  13783 ccctaatttttacctggaccgccctttcgggttttcgatccac 13741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 15879 - 16028
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    |||||||| |||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  15879 atttttgcttggaccgccctttcgggttttctgtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 15978  T
Q  264 t---catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |    |||||||||| | |||||||||||||||  ||||| |||||||||    
T  15979 tatatatatatctagacaaagtatttcttgactgcatcagaattcacagg 16028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 15201 - 15277
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||   |||||| ||||||||||||||||  || || |||||||||||| || ||||||||||||||||    
T  15201 ttttgcctggacttcccttttgggttttcgatccaccatgatgctcatttttgcctaagctgccctttcgggttttc 15277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 27715 - 27780
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    ||||||||||||| ||||||||| | |||||  ||||||| || || |||||||||||| ||||||    
T  27715 atttttgcctggaccgccctttcagtttttcagtccaccgagacgctcatttttgcctaagccgcc 27780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: scaffold0046
Description:

Target: scaffold0046; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 165 - 307
Target Start/End: Complemental strand, 51675 - 51527
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  51675 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 51576  T
Q  264 t-----catatatctaggcgaagtatttcttgactatatcagcattcac 307  Q
    |      |||||||||| | |||||||||||||||  ||||| ||||||    
T  51575 tatatatatatatctagacaaagtatttcttgactgcatcagaattcac 51527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 160 - 251
Target Start/End: Complemental strand, 52348 - 52254
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt---gcctaggccgccctttcgggttttcgacctacc 251  Q
    |||| |||||| |||||| ||||||||||||||||||||||||| ||  || | |||||   |  ||||||||||| ||||||||||||||||||    
T  52348 ccctaatttttacctggaccgccctttcgggttttcgatccaccagggcgctcttttttttggtttaggccgccctctcgggttttcgacctacc 52254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1837 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: scaffold1837
Description:

Target: scaffold1837; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 165 - 310
Target Start/End: Original strand, 1168 - 1315
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  1168 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 1267  T
Q  264 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
    |  |  ||| ||| | |||||||||||||||  ||||| |||||||||    
T  1268 tgtaactatttagacaaagtatttcttgactgcatcagaattcacagg 1315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1837; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 527 - 607
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc----atttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||||||||| |||||||| |||||||||||  | |     |||||||||| |||||||||||||||||||    
T  527 ttttgcctggatcgcccttttgggttttcaatccaccgggatactctcttttttttgcctaagccgccctttcgggttttc 607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 52; Significance: 8e-21; HSPs: 5)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 165 - 263
Target Start/End: Complemental strand, 31939 - 31840
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 263  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  31939 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 31840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 89740 - 89661
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||| || | |||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  89740 ttttgcctagaccaccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 89661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 218
Target Start/End: Original strand, 8034 - 8087
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 218  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||    
T  8034 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcattttt 8087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 31939 - 31882
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  31939 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 31882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 90455 - 90415
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  90455 ttttgcctggaccgccctttcgggttttcagtccaccggga 90415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 165 - 310
Target Start/End: Complemental strand, 33095 - 32952
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt 264  Q
    ||||||||||||| |||| ||||||||||||  ||||||| || || || ||||||||| | |||||||||||||||||||| ||||  | |||||||||    
T  33095 atttttgcctggaccgccatttcgggttttcagtccaccgagacgctcagttttgcctaagtcgccctttcgggttttcgacttaccgagttgttctttt 32996  T
Q  265 catatatctaggcgaagtatttcttgactatatcagcattcacagg 310  Q
     || | | ||| | |||||||||||||||| ||||| |||||||||    
T  32995 -at-tttttagacaaagtatttcttgactacatcagaattcacagg 32952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 33770 - 33702
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 235  Q
    ||||| ||||||||||||||||||||||| ||||||   ||  | |||||||||||| |||||| ||||    
T  33770 ttttgtctggatcgccctttcgggttttcaatccactatgacactcatttttgcctaagccgccttttc 33702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0799 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: scaffold0799
Description:

Target: scaffold0799; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 5226 - 5309
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||| || |||| |||||||    
T  5226 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttgcctaagccaccttttcaggttttc 5309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0799; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 262
Target Start/End: Complemental strand, 329 - 228
Alignment:
Q  162 cttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttc 260  Q
    ||||||||||||||   |||||||||||||||||   |||||| || || ||||||| |||| ||||||| ||||||||||||||| ||||  |||||||    
T  329 cttatttttgcctgagccgccctttcgggttttcagcccaccgagacgctcattttttcctaagccgcccttttcgggttttcgacttaccgagctgttc 230  T
Q  261 tt 262  Q
    ||    
T  229 tt 228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0799; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 326 - 276
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcatt 103  Q
    |||||||| ||| |||||||||||||||||| || || |||||||||||||    
T  326 atttttgcctgagccgccctttcgggttttcagcccaccgagacgctcatt 276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: scaffold0257
Description:

Target: scaffold0257; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 237 - 150
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  237 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 208
Target Start/End: Complemental strand, 276 - 247
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||||||||||||||||||||||    
T  276 cgccctttcgggttttcgatccaccgggaa 247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 84
Target Start/End: Complemental strand, 288 - 259
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcg 84  Q
    ||||||||||||||||||||||||||||||    
T  288 ttttgcatgaaccgccctttcgggttttcg 259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 69111 - 69198
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  69111 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 69198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 69047 - 69088
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||||| || ||||||||||||||||| ||||||||||||    
T  69047 ttttgcctagaccgccctttcgggttttcaatccaccgggaa 69088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 19383 - 19302
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  19383 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 19302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 19383 - 19326
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  19383 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 19326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0157 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0157
Description:

Target: scaffold0157; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 262
Target Start/End: Original strand, 3278 - 3375
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 262  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||| |||||||||||||||||| ||||  |||||||||    
T  3278 attttttcctggaccgccctttcgggttttcattccaccgagacgctcattttttcctaagccaccctttcgggttttcgacttaccgagctgttctt 3375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 30027 - 30108
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||| ||||||  ||||||| || || |||||||||||| ||||||||||| ||||||||||    
T  30027 atttttgcctggaccgccctttcgagttttctgtccaccgagacgctcatttttgcctaagccgccctttcaggttttcgac 30108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 29251 - 29291
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  29251 ttttgcctggaccgccctttcgggttttcagtccaccggga 29291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: scaffold1418
Description:

Target: scaffold1418; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 1400 - 1487
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||||||||||||||||| ||||| ||||| || ||||||| || || |||||||||||| |||||||||    
T  1400 ccctaatttttgcctggaccgccctttcgggttttcaatccatcgggacgctcatttttggcttaagccgccctttcgagttttcgac 1487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 244
Target Start/End: Original strand, 422 - 507
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcg 244  Q
    |||| ||||||||||||| | |||||||||||||| |||||| | ||  || ||||||| || || ||||||||||||||||||||    
T  422 ccctaatttttgcctggacctccctttcgggtttttgatccatcagggcgctcatttttggcttaagccgccctttcgggttttcg 507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 1336 - 1377
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||| ||||||||||||||||| ||||||||||||    
T  1336 ttttgtctggaccgccctttcgggttttcaatccaccgggaa 1377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0605 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: scaffold0605
Description:

Target: scaffold0605; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 3371 - 3458
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||  | ||||||| || || || |||||||||||||||||||    
T  3371 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacactcatttttggcttaagctgccctttcgggttttcgac 3458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0605; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 3311 - 3352
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  3311 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 3352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0605; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 4141 - 4196
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  4141 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 4196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0357
Description:

Target: scaffold0357; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 10539 - 10460
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  10539 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 10460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 11243 - 11160
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  ||| |||||| || |||||||||||| |||||| |||| |||||||    
T  11243 ccctaatttttgcctggaccgccctttcgggttttcagtcccccgggacgctcatttttgcctaagccgccttttcaggttttc 11160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: scaffold0132
Description:

Target: scaffold0132; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 28414 - 28331
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| | |||| |||| |||||||    
T  28414 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagtcgccttttcaggttttc 28331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 27697 - 27616
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  27697 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 27616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 32677 - 32596
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  32677 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 32596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 173226 - 173139
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||||||||||||||||   |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  173226 ccctaatttttgcctggaccgccctttcgggtttttagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 173139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 40974 - 41105
Alignment:
Q  18 gccagatatagttacttgccttttgtttcaatctc-atttttg-catgaaccgccctttcggg--ttttcggct--catcgagacgctcattctt--gcc 109  Q
    ||||||||||||||||||||| | ||||||||||| ||||||| |||||||||||||| ||||  |||||||||   ||||||||||||||||||   ||    
T  40974 gccagatatagttacttgcctctcgtttcaatctctatttttgtcatgaaccgcccttccggggtttttcggcttcgatcgagacgctcattctttgtcc 41073  T
Q  110 tgagttg-cgtacaatctcagcg-agcttttt 139  Q
    |||||||  |||||||||||||| ||||||||    
T  41074 tgagttgttgtacaatctcagcgtagcttttt 41105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 306
Target Start/End: Original strand, 41173 - 41292
Alignment:
Q  198 tccaccgggaagcgc-attttt--gcctaggcc-gcccttt-cgggtttt-cgacctaccacgc-tgttc-ttttca-tatatctaggcgaag-tatttc 287  Q
    ||||||||||||||| ||||||  ||||||||| ||||||| |||||||| ||||||||||||| ||||| |||||| ||| ||||||| ||| ||||||    
T  41173 tccaccgggaagcgctattttttcgcctaggcccgcccttttcgggtttttcgacctaccacgcttgttctttttcattatttctaggcaaagttatttc 41272  T
Q  288 ttgactatat-cagcattca 306  Q
    |||||||||| |||||||||    
T  41273 ttgactatatccagcattca 41292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 5)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 251
Target Start/End: Complemental strand, 1689 - 1603
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 251  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  1689 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 1603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 2419 - 2333
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||| ||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| ||||||||||    
T  2419 ccctaattttagcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttcgac 2333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 181803 - 181886
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||| ||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  181803 ccctaatttttgcctggaccgcccttttgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 181886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 1689 - 1632
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  1689 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 1632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 2478 - 2437
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  2478 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 2437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0582 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 3)
Name: scaffold0582
Description:

Target: scaffold0582; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 3601 - 3682
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  3601 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0582; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 2882 - 2965
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| | |||||  ||||||||  |||||||||| || |||||||||||| || ||| |||| |||||||    
T  2882 ccctaatttttgcctggaccacccttctgggttttcagtccaccgggacgctcatttttgcctaagctgccttttcaggttttc 2965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0582; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 3601 - 3658
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || ||||||||||||||||||| |  || ||||||||||||| ||||||    
T  3601 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcct 3658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 4)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 154955 - 154914
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  154955 atttttgcctggatcgccctttcgggttttcgatccaccggg 154914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 160 - 243
Target Start/End: Original strand, 15195 - 15279
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 243  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || |||||||||| | |||| |||| |||||||    
T  15195 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcattttttgcctaagtcgccttttcaggttttc 15279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 15932 - 16013
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||| ||||||||  |||| || || || |||||||||||| |||||| |||| ||||| ||||    
T  15932 atttttgcctggaccgcccttttgggttttcagtccatcgagacgctcatttttgcctaagccgccttttcaggtttgcgac 16013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 15932 - 15989
Alignment:
Q  53 atttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    |||||||| || |||||||||| |||||||| |  |||||||||||||||| ||||||    
T  15932 atttttgcctggaccgcccttttgggttttcagtccatcgagacgctcatttttgcct 15989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0094 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0094
Description:

Target: scaffold0094; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 262
Target Start/End: Original strand, 32738 - 32837
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctt 262  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||||||  |||| ||||||||||| ||||  |||||||||    
T  32738 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcattttttcctaagccgccctcttttgggttttcgacttaccgagctgttctt 32837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 21035 - 20955
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  21035 ttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 20955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0451 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0451
Description:

Target: scaffold0451; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 272 - 185
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||| ||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  272 ccctaatttttgtctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0389 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0389
Description:

Target: scaffold0389; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 5288 - 5201
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| | ||||||||||||| |  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  5288 ccctaatttttgcctggaccaccctttcgggtttccagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 5201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 21180 - 21259
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  21180 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 21259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 20394 - 20443
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  20394 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 20443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 21097 - 21010
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    |||| ||||||||||||| ||||||||| |||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  21097 ccctaatttttgcctggaccgccctttcaggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 21010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 21163 - 21114
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||| ||||||||||||| ||||||||||||||||| ||||| ||||||    
T  21163 tccctaatttttgcctggaccgccctttcgggttttcaatccatcgggaa 21114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0243
Description:

Target: scaffold0243; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 18646 - 18565
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  18646 atttttgcctggaccgcccttttgggttttcactccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 18565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 19361 - 19320
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    |||||| |||| |||||||||||||||||| |||||||||||    
T  19361 ttttgcttggaccgccctttcgggttttcggtccaccgggaa 19320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0093 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0093
Description:

Target: scaffold0093; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 367 - 326
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccggg 206  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  367 atttttgcctggatcaccctttcgggttttcgatccaccggg 326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0093; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 299 - 223
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||| |  |||||| |||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  299 ttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0320 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0320
Description:

Target: scaffold0320; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 2660 - 2739
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  2660 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 2739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 293
Target Start/End: Complemental strand, 155101 - 154976
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt 264  Q
    ||||||||||||| ||||||||||||||||| ||||||   || || ||||||| |||| |||||| |||| ||||| |||| |||   |||||||||      
T  155101 atttttgcctggaccgccctttcgggttttcaatccactaagacgctcattttttcctaagccgccttttcaggtttgcgacttacggagctgttctt-- 155004  T
Q  265 catatatctaggcgaagtatttcttgact 293  Q
     |||| | ||| | |||||||||||||||    
T  155003 -atatttttagacaaagtatttcttgact 154976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0721 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold0721
Description:

Target: scaffold0721; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 243
Target Start/End: Original strand, 5530 - 5595
Alignment:
Q  179 cgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 243  Q
    |||||||||||||||||| |||||||||| || || |||||||||| |||||| |||| |||||||    
T  5530 cgccctttcgggttttcggtccaccgggacgctcattttttgcctaagccgccttttcaggttttc 5595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0721; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 5453 - 5494
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 208  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  5453 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 5494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0441 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0441
Description:

Target: scaffold0441; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 8131 - 8050
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || ||||||| |||| |||||| |||| ||||| ||||    
T  8131 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttccctaagccgccttttcaggtttgcgac 8050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold0125
Description:

Target: scaffold0125; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 246
Target Start/End: Complemental strand, 13413 - 13332
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||||| ||||||||  |||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  13413 atttttgcctggaccgccctttttggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 13332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 14112 - 14065
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  14112 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 14065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1056 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1056
Description:

Target: scaffold1056; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 1168 - 1208
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||||||||| |||||||||||||||||| ||||||||||    
T  1168 ttttgcctggaccgccctttcgggttttcggtccaccggga 1208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0932 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0932
Description:

Target: scaffold0932; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 3812 - 3736
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 243  Q
    ||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  3812 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 3736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1691 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: scaffold1691
Description:

Target: scaffold1691; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 452 - 397
Alignment:
Q  55 ttttgcatgaaccgccctttcgggttttcggctcatcgagacgctcattcttgcct 110  Q
    ||||||||| ||||||||||||||||||| |  ||||||||||||| || ||||||    
T  452 ttttgcatggaccgccctttcgggttttcagtccatcgagacgctcttttttgcct 397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1691; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 1237 - 1157
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 246  Q
    ||||||||||| ||||||||  |||||||  |||||| ||| || ||||||| || || ||||||||| ||||||||||||    
T  1237 ttttgcctggaccgcccttttaggttttcagtccaccaggatgctcatttttggcttaagccgcccttgcgggttttcgac 1157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1661 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1661
Description:

Target: scaffold1661; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 1250 - 1171
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||||| || | |||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  1250 ttttgcctagaccaccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 1171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 79728 - 79686
Alignment:
Q  160 cccttatttttgcctggatcgccctttcgggttttcgatccac 202  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  79728 ccctaatttttacctggatcaccctttcgggttttcgatccac 79686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 79799 - 79761
Alignment:
Q  167 ttttgcctggatcgccctttcgggttttcgatccaccgg 205  Q
    |||||||||||||| |||||||| |||||||||||||||    
T  79799 ttttgcctggatcgtcctttcggattttcgatccaccgg 79761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0183 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0183
Description:

Target: scaffold0183; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 230
Target Start/End: Complemental strand, 33469 - 33404
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 230  Q
    ||||||||||||| ||||||||||||||||   ||||||| || || |||||||||| | ||||||    
T  33469 atttttgcctggaccgccctttcgggtttttagtccaccgagacgctcatttttgccgaagccgcc 33404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 246
Target Start/End: Original strand, 190609 - 190690
Alignment:
Q  165 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 246  Q
    |||||| ||||||||||||||| ||||||||  ||||||| |  || |||||||| ||| |||||| |||| ||||| ||||    
T  190609 attttttcctggatcgcccttttgggttttcagtccaccgagtcgctcatttttgtctaagccgccttttccggtttgcgac 190690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0327 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0327
Description:

Target: scaffold0327; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 16451 - 16403
Alignment:
Q  159 tcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 207  Q
    ||||| |||||||||||||  ||||||||||||||||  ||||||||||    
T  16451 tccctaatttttgcctggacagccctttcgggttttcagtccaccggga 16403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University