View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6881_low_4 (Length: 283)
Name: NF6881_low_4
Description: NF6881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6881_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 5 - 267
Target Start/End: Complemental strand, 22362060 - 22361798
Alignment:
| Q |
5 |
gcaatgcaatggaagcagaaatcaaagtaggagacatattctacataccaagatactttcctttctgtcaaatagctgcaagaaatggacccttagagtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362060 |
gcaatgcaatggaagcagaaatcaaagtaggagacatattctacataccaagatactttcctttctgtcaaatagctgcaagaaatggacccttagagtt |
22361961 |
T |
|
| Q |
105 |
ctttggattcacaacctcatcaaaaaagagccatccacagtttctagcaggtgctgcatcacttcttaagaccattttgggacctgaacttgcagctgca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361960 |
ctttggattcacaacctcatcaaaaaagagctatccacagtttctagcaggtgctgcatcacttcttaagaccattttgggacctgaacttgcagctgca |
22361861 |
T |
|
| Q |
205 |
tttggtgtgagtgagggcactatgaaggacgtcgtcgatgctcaacgcgaagctgtaatactt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22361860 |
tttggtgtgagtgagggcactatgaaggacgtcgtcgatgctcaacgtgaagctgtaatactt |
22361798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University