View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6882_low_12 (Length: 301)
Name: NF6882_low_12
Description: NF6882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6882_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 271
Target Start/End: Complemental strand, 30782053 - 30781801
Alignment:
| Q |
19 |
ctttgaacatcgcttattgtaccaatggttgcaagaaaagggacggtttactttgctttgaatcattcctatcatcagcaaagacctaattccaagtctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30782053 |
ctttgaacatcgcttattgtaccaatggttgcaagagaagggaccgtttactttgctttgaatcattcctatcatcagcaaagacctaattcctagtctt |
30781954 |
T |
 |
| Q |
119 |
caaggcaggcgaatccaaaaggactaaaaggaataagtttcctataccctagatggcataggaacatttagaggttagagtagagctcacttctccactc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781953 |
caaggcaggcgaatccaaaaggactaaaaggaataagtttcctataccctagatggcataggaacatttagaggttagagtagagctcacttctccactc |
30781854 |
T |
 |
| Q |
219 |
ggttcttaatacgtggattttagaataaagattgatagacattcaaaactctt |
271 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
30781853 |
ggttcttaatacgtgggttttagaataaagattgatagacactcaaaattctt |
30781801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University