View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6882_low_17 (Length: 249)
Name: NF6882_low_17
Description: NF6882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6882_low_17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 50751622 - 50751851
Alignment:
| Q |
20 |
atacggaccggcaattaaatcccnnnnnnnatgtgtagagtgcatatccaccatatagtcgctatcgttaatataacctttgtgataaaccgataatgct |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50751622 |
atacggaccggcaattaaatccctttttttatgtgtagagtgcatatccaccatatagtcgctatcgttaatataacctttgtgataaaccgataatgct |
50751721 |
T |
 |
| Q |
120 |
tgggagaccaagtttaccaaaaacacaaacaatattagactcggcggtatgtatgtgatcatgtgaatctcttataggattcctatatgttctaataaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50751722 |
tgggagaccaagtttaccaaaaacacaaacaatattagactcggcggtatgtatgtgatcatgtgaatctcttataggattcctatatgttctaataaca |
50751821 |
T |
 |
| Q |
220 |
tttggagaagaagaatggatgaggagatcc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50751822 |
tttggagaagaagaatggatgaggagatcc |
50751851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University