View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6883_high_21 (Length: 230)
Name: NF6883_high_21
Description: NF6883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6883_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 31 - 216
Target Start/End: Complemental strand, 30555515 - 30555332
Alignment:
| Q |
31 |
ttcaaagaaagttataataattgttaggttgatatttcttcttcgtctggccagaattaatgaattatacatcaagttgaaaagtannnnnnnnnnnnnn |
130 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30555515 |
ttcaaagaaagtta--ataattgttaggttgatatttcttgttcgtctggccagaattaatgaattatacatcaagttgaaaagtaattttcttttttat |
30555418 |
T |
|
| Q |
131 |
nnnngcgtgtacacaatcataaatagttatgtgaaaatatagagcttttatgtgtcgttaattaatttacgattgcccgtgtgtgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30555417 |
ttttgcgtgtacacaatcataaatagttatgtgaaaatatagagcttttatgtgtcgttaattaatttacgattgcctgtgtgtgc |
30555332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University