View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6883_high_26 (Length: 209)

Name: NF6883_high_26
Description: NF6883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6883_high_26
NF6883_high_26
[»] chr4 (1 HSPs)
chr4 (13-195)||(43219508-43219689)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 43219508 - 43219689
Alignment:
13 gagaagaatggcgggttcttctccttatgccggtgagagagagcgagggcgaaaaccttgaagaattatcatatgatgaagggttttgtagctgcttgaa 112  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
43219508 gagaagaatggcgg-ttcttctccttatgccggtgagagagagcgagggcaaaaaccttgaagaattatcatatgatgaagggttttgtagctgcttgaa 43219606  T
113 aggcttaacagaatttgatataatagggaatttggtttcggtgtgcaagagtgaattaggtagaaagagtaagcttgatcctg 195  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
43219607 aggcttaacagaatttgatataatagggaatttggttttggtgtgcaagagtgaattaggtagaaagagtaagcttgatcctg 43219689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University