View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6883_low_28 (Length: 223)
Name: NF6883_low_28
Description: NF6883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6883_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 100 - 210
Target Start/End: Complemental strand, 36049575 - 36049462
Alignment:
| Q |
100 |
agggatactattattcttct---atcgatttctttttcttcttatataacggaaaagtattctagttaaatgtttgataataatttttataatcatattt |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36049575 |
agggatactattattcttcttctatcgatttctttttcttcttatataaccgaaaagtattctcgttgaatgttttataataatttttataatcatattt |
36049476 |
T |
 |
| Q |
197 |
caaaatcaataatt |
210 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36049475 |
caaaatcaataatt |
36049462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 36050043 - 36049982
Alignment:
| Q |
16 |
atgaaagccaaatcgcagcagcagttaacttatttcagttcctcaacgataattaattacca |
77 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36050043 |
atgaaagccaaatcgcaagagtagttaacttatttcagttcctcaacgataattaattacca |
36049982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University