View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6883_low_29 (Length: 212)
Name: NF6883_low_29
Description: NF6883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6883_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 32 - 192
Target Start/End: Original strand, 30150217 - 30150377
Alignment:
| Q |
32 |
ctgctctaattgtgattcatgtagtgatttctctttcttagtggcagaactaaatacatctaaatctgtgtacttactggacaactgcccgcatgattgg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30150217 |
ctgctctaattgtgattcatgtagtgatttctctttcttagtggcagaactaaatacatctaaatctgtgtacttactggacaactgcccgcatgattgg |
30150316 |
T |
|
| Q |
132 |
ctgtttccacgatgcgctgctgtggtacctactaaacttttcttggtagaaagtacagttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30150317 |
ctgtttccacgatgcgctgctgtggtacctactaaacttttcttggtagaaagtacagttg |
30150377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University