View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6886_high_5 (Length: 206)
Name: NF6886_high_5
Description: NF6886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6886_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 20479804 - 20479702
Alignment:
| Q |
13 |
gtagcagagaggacaagatcagctacaaaattaggaccgaaacatccactacacacccttttaagacggaagcacctacaccaactaggaaatgtacaga |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
20479804 |
gtagcagagaggacaagataggctacaaaattaggaccgaaacatccactacacacccttttaagaccgaaacacatacaccaactaggaaatgtacaga |
20479705 |
T |
|
| Q |
113 |
ggg |
115 |
Q |
| |
|
||| |
|
|
| T |
20479704 |
ggg |
20479702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University