View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6887_low_3 (Length: 336)
Name: NF6887_low_3
Description: NF6887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6887_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 5 - 193
Target Start/End: Complemental strand, 1502568 - 1502380
Alignment:
| Q |
5 |
agtttcgtgttaggtgttcatgtcaatacttcatttatccaaaccacatttaaaatctgcatgtgaatgtgaggcatgcatggtctagattttaagctcg |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1502568 |
agtttcatgttaggtgttcatgtcaatacttcatttatccaaaccacatttaaaatctacatgtgaatgtgaggcatgcatggtctagattttaagctcg |
1502469 |
T |
 |
| Q |
105 |
attttttaaatttaaagaaaatcaaaaccagctttaaaatctacatgcaagacatgcataccgtcatctcaatcatgcattttatatcc |
193 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1502468 |
attttttaaatttaaagaaaatcaataccagctttaaaatctacatgcaagacatgcataccgtcatctcaatcatgcatattatatcc |
1502380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 247 - 282
Target Start/End: Complemental strand, 1502326 - 1502291
Alignment:
| Q |
247 |
ccatcttcttgctatatgtaactcaacctacactac |
282 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1502326 |
ccatcttctcgctatatgtaactcaacctacactac |
1502291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 93 - 133
Target Start/End: Complemental strand, 1502716 - 1502676
Alignment:
| Q |
93 |
attttaagctcgattttttaaatttaaagaaaatcaaaacc |
133 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
1502716 |
attttaagctcggatttttagatttaaagaaaatcaaaacc |
1502676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 131
Target Start/End: Original strand, 11734211 - 11734254
Alignment:
| Q |
88 |
tctagattttaagctcgattttttaaatttaaagaaaatcaaaa |
131 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
11734211 |
tctagattttaaacttgattttttaaatttaaagaaaatcaaaa |
11734254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University