View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6888_low_11 (Length: 246)

Name: NF6888_low_11
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6888_low_11
NF6888_low_11
[»] chr7 (1 HSPs)
chr7 (7-246)||(41185619-41185854)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 41185619 - 41185854
Alignment:
7 gagatggacatcagagaggtaaacaaagaaatatcatatattgaaatgaatggcatgaactgaaagttaattacaagaatcatnnnnnnnnnnnnnnnag 106  Q
    |||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||               ||    
41185619 gagatgaaaatcagagaggtaaacaaagaaatctcatatattgaaatgaatggcatgaactgaaagttaattacaagaatcatacacacacaca----ag 41185714  T
107 ggaataaagctaggtgacttgtaacacaagtaatctgttataactaactttctatcatctattacttaaatgtaactggttataataaccggttgtcaac 206  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
41185715 tgaataaagctaggtgacttgtaacacaagtaatctgttataactaactttctatcatctatgacttaaatgtaactggttataataaccggttgtcaac 41185814  T
207 tggatggagtagtatcctctaacaagacgacttgtgcaat 246  Q
    ||||||||||||||||||||||||||| ||||||||||||    
41185815 tggatggagtagtatcctctaacaagatgacttgtgcaat 41185854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University