View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6888_low_14 (Length: 240)
Name: NF6888_low_14
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6888_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 53 - 157
Target Start/End: Complemental strand, 46512801 - 46512697
Alignment:
| Q |
53 |
ttttatcaatctgttttaaacatagatttgctgcattttgcagacactagaaggtgcagtaatatattatccgagtttctgaataagaaacgcttctgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
46512801 |
ttttatcaatctgttttaaacatagatttgctacattttgaagacactagaagatgcagtaatatattatccgactttctgaataaaaaaagcttctgca |
46512702 |
T |
|
| Q |
153 |
ctttt |
157 |
Q |
| |
|
||||| |
|
|
| T |
46512701 |
ctttt |
46512697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 29540289 - 29540213
Alignment:
| Q |
15 |
tcaaggatgaaaattttagaacagtgaaagaaagatacttttatcaatctgttttaaacatagatttgctgcatttt |
91 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||| || |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29540289 |
tcaaggatgaaaattttagaatagggaaagaaggataagttgatcaatctgtttcaaacatagatttgctccatttt |
29540213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University