View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6888_low_16 (Length: 229)
Name: NF6888_low_16
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6888_low_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 48141876 - 48142085
Alignment:
| Q |
20 |
gcataccgttccttatcacatgcaatcaggcatataaatgaatgagttgctaaagcaaagtggtctacttttaactttatttaagtttctactttctact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48141876 |
gcataccgttccttatcacatgcaatcaggcatataaatgaatgaattgctaaagcaaagtgttctacttttaactttatttaagtttctactttctact |
48141975 |
T |
|
| Q |
120 |
atatactttattccttttgaaaaagctctattctttacnnnnnnngttactttgttatttgccttgctgctcgtgattgatgtttatgacacctaaattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48141976 |
atatactttattccttttgaaaaagctctattctttactttttttgttactttgttatttgccttgctgctcgtgattgatgtttatgacacctaaattt |
48142075 |
T |
|
| Q |
220 |
gtaactattc |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
48142076 |
gtaactattc |
48142085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University