View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6888_low_17 (Length: 227)
Name: NF6888_low_17
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6888_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 48142276 - 48142456
Alignment:
| Q |
19 |
ccttggatgagtgtcggcaccttatttattgttcctgtttacccaactttcactgtttaaattgattattatagttatggttatgatgannnnnnnnaac |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
48142276 |
cctttgatgagtgtcggcaccttatttattgttcctgtttacccaactttcactgtttaaattgattattatagttatggttatgattattttttttaac |
48142375 |
T |
|
| Q |
119 |
aaccccccgtttagggtacaactctaataatttgaagttttgtcagatgataactaaaatctgatcaatgttttaaccaga |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48142376 |
aaccccccgtttaggggacaactctaataatttgaagttttgtcagatgataactaaaatctgatcaatgttttaaccaga |
48142456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University